2XQL
 
 | | Fitting of the H2A-H2B histones in the electron microscopy map of the complex Nucleoplasmin:H2A-H2B histones (1:5). | | Descriptor: | HISTONE H2A-IV, HISTONE H2B 5 | | Authors: | Ramos, I, Martin-Benito, J, Finn, R, Bretana, L, Aloria, K, Arizmendi, J.M, Ausio, J, Muga, A, Valpuesta, J.M, Prado, A. | | Deposit date: | 2010-09-02 | | Release date: | 2010-11-03 | | Last modified: | 2024-05-08 | | Method: | ELECTRON MICROSCOPY (19.5 Å) | | Cite: | Nucleoplasmin Binds Histone H2A-H2B Dimers Through its Distal Face.
J.Biol.Chem., 285, 2010
|
|
4NFT
 | | Crystal structure of human lnkH2B-h2A.Z-Anp32e | | Descriptor: | Acidic leucine-rich nuclear phosphoprotein 32 family member E, Histone H2B type 2-E, Histone H2A.Z | | Authors: | Shan, S, Pan, L, Mao, Z, Wang, W, Sun, J, Dong, Q, Liang, X, Ding, X, Chen, S, Dai, L, Zhang, Z, Zhu, B, Zhou, Z. | | Deposit date: | 2013-11-01 | | Release date: | 2014-04-09 | | Last modified: | 2024-03-20 | | Method: | X-RAY DIFFRACTION (2.61 Å) | | Cite: | Anp32e, a higher eukaryotic histone chaperone directs preferential recognition for H2A.Z
Cell Res., 24, 2014
|
|
4M6B
 | | Crystal structure of yeast Swr1-Z domain in complex with H2A.Z-H2B dimer | | Descriptor: | Chimera protein of Histone H2B.1 and Histone H2A.Z, Helicase SWR1 | | Authors: | Hong, J.J, Feng, H.Q, Wang, F, Ranjan, A, Chen, J.H, Jiang, J.S, Girlando, R, Xiao, T.S, Wu, C, Bai, Y.W. | | Deposit date: | 2013-08-09 | | Release date: | 2014-02-19 | | Last modified: | 2024-02-28 | | Method: | X-RAY DIFFRACTION (1.78 Å) | | Cite: | The Catalytic Subunit of the SWR1 Remodeler Is a Histone Chaperone for the H2A.Z-H2B Dimer.
Mol.Cell, 53, 2014
|
|
2YFV
 | |
4R8P
 | | Crystal structure of the Ring1B/Bmi1/UbcH5c PRC1 ubiquitylation module bound to the nucleosome core particle | | Descriptor: | DNA (147-mer), E3 ubiquitin-protein ligase RING2, Ubiquitin-conjugating enzyme E2 D3, ... | | Authors: | McGinty, R.K, Henrici, R.C, Tan, S. | | Deposit date: | 2014-09-02 | | Release date: | 2014-11-05 | | Last modified: | 2023-09-20 | | Method: | X-RAY DIFFRACTION (3.2846 Å) | | Cite: | Crystal structure of the PRC1 ubiquitylation module bound to the nucleosome.
Nature, 514, 2014
|
|
1F66
 | | 2.6 A CRYSTAL STRUCTURE OF A NUCLEOSOME CORE PARTICLE CONTAINING THE VARIANT HISTONE H2A.Z | | Descriptor: | HISTONE H2A.Z, HISTONE H2B, HISTONE H3, ... | | Authors: | Suto, R.K, Clarkson, M.J, Tremethick, D.J, Luger, K. | | Deposit date: | 2000-06-20 | | Release date: | 2000-11-27 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Crystal structure of a nucleosome core particle containing the variant histone H2A.Z.
Nat.Struct.Biol., 7, 2000
|
|
6Y36
 | | CCAAT-binding complex from Aspergillus fumigatus with cccA DNA | | Descriptor: | CCAAT-binding factor complex subunit HapC, CCAAT-binding factor complex subunit HapE, CCAAT-binding transcription factor subunit HAPB, ... | | Authors: | Groll, M, Huber, E.M. | | Deposit date: | 2020-02-17 | | Release date: | 2020-05-27 | | Last modified: | 2024-01-24 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Structural basis of HapE P88L -linked antifungal triazole resistance in Aspergillus fumigatus .
Life Sci Alliance, 3, 2020
|
|
6Y35
 | | CCAAT-binding complex from Aspergillus fumigatus with cycA DNA | | Descriptor: | CCAAT-binding factor complex subunit HapC, CCAAT-binding factor complex subunit HapE, CCAAT-binding transcription factor subunit HAPB, ... | | Authors: | Groll, M, Huber, E.M. | | Deposit date: | 2020-02-17 | | Release date: | 2020-05-27 | | Last modified: | 2024-01-24 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Structural basis of HapE P88L -linked antifungal triazole resistance in Aspergillus fumigatus .
Life Sci Alliance, 3, 2020
|
|
1KX3
 | | X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution | | Descriptor: | DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3'), MANGANESE (II) ION, histone H2A.1, ... | | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | | Deposit date: | 2002-01-31 | | Release date: | 2002-12-25 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
|
|
1KX4
 | | X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution | | Descriptor: | CHLORIDE ION, DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3'), MANGANESE (II) ION, ... | | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | | Deposit date: | 2002-01-31 | | Release date: | 2002-12-25 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
|
|
1KX5
 | | X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution | | Descriptor: | CHLORIDE ION, DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), ... | | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | | Deposit date: | 2002-01-31 | | Release date: | 2002-12-25 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (1.94 Å) | | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
|
|
8A3Y
 | | Structure of mammalian Pol II-DSIF-SPT6-PAF1-TFIIS-hexasome elongation complex | | Descriptor: | DNA-directed RNA polymerase II subunit E, DNA-directed RNA polymerase II subunit RPB11-a, DNA-directed RNA polymerase II subunit RPB3, ... | | Authors: | Farnung, L, Ochmann, M, Garg, G, Vos, S.M, Cramer, P. | | Deposit date: | 2022-06-09 | | Release date: | 2024-07-31 | | Last modified: | 2024-11-06 | | Method: | ELECTRON MICROSCOPY (3.3 Å) | | Cite: | Structure of a backtracked hexasomal intermediate of nucleosome transcription.
Mol.Cell, 82, 2022
|
|
5KGF
 | | Structural model of 53BP1 bound to a ubiquitylated and methylated nucleosome, at 4.5 A resolution | | Descriptor: | DNA (145-MER), Histone H2A type 1, Histone H2B type 1-C/E/F/G/I, ... | | Authors: | Wilson, M.D, Benlekbir, S, Sicheri, F, Rubinstein, J.L, Durocher, D. | | Deposit date: | 2016-06-13 | | Release date: | 2016-07-27 | | Last modified: | 2024-11-13 | | Method: | ELECTRON MICROSCOPY (4.54 Å) | | Cite: | The structural basis of modified nucleosome recognition by 53BP1.
Nature, 536, 2016
|
|
5KDM
 | |
8ATF
 | | Nucleosome-bound Ino80 ATPase | | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, DNA (226-MER), DNA (227-MER), ... | | Authors: | Kunert, F, Metzner, F.J, Eustermann, S, Jung, J, Woike, S, Schall, K, Kostrewa, D, Hopfner, K.P. | | Deposit date: | 2022-08-23 | | Release date: | 2022-12-14 | | Last modified: | 2024-07-24 | | Method: | ELECTRON MICROSCOPY (3.45 Å) | | Cite: | Structural mechanism of extranucleosomal DNA readout by the INO80 complex.
Sci Adv, 8, 2022
|
|
2PYO
 | | Drosophila nucleosome core | | Descriptor: | CHLORIDE ION, DNA (147-MER), Histone H2A, ... | | Authors: | Clapier, C.R, Petosa, C, Mueller, C.W. | | Deposit date: | 2007-05-16 | | Release date: | 2007-11-06 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (2.43 Å) | | Cite: | Structure of the Drosophila nucleosome core particle highlights evolutionary constraints on the H2A-H2B histone dimer.
Proteins, 71, 2007
|
|
1ID3
 | | CRYSTAL STRUCTURE OF THE YEAST NUCLEOSOME CORE PARTICLE REVEALS FUNDAMENTAL DIFFERENCES IN INTER-NUCLEOSOME INTERACTIONS | | Descriptor: | HISTONE H2A.1, HISTONE H2B.2, HISTONE H3, ... | | Authors: | White, C.L, Suto, R.K, Luger, K. | | Deposit date: | 2001-04-03 | | Release date: | 2001-09-28 | | Last modified: | 2023-08-09 | | Method: | X-RAY DIFFRACTION (3.1 Å) | | Cite: | Structure of the yeast nucleosome core particle reveals fundamental changes in internucleosome interactions.
EMBO J., 20, 2001
|
|
1HQ3
 | | CRYSTAL STRUCTURE OF THE HISTONE-CORE-OCTAMER IN KCL/PHOSPHATE | | Descriptor: | CHLORIDE ION, HISTONE H2A-IV, HISTONE H2B, ... | | Authors: | Chantalat, L, Nicholson, J.M, Lambert, S.J, Reid, A.J, Donovan, M.J, Reynolds, C.D, Wood, C.M, Baldwin, J.P. | | Deposit date: | 2000-12-14 | | Release date: | 2001-01-24 | | Last modified: | 2023-08-09 | | Method: | X-RAY DIFFRACTION (2.15 Å) | | Cite: | Structure of the histone-core octamer in KCl/phosphate crystals at 2.15 A resolution.
Acta Crystallogr.,Sect.D, 59, 2003
|
|
2NZD
 | | Nucleosome core particle containing 145 bp of DNA | | Descriptor: | DNA (145-MER), Histone H2B, Histone H3, ... | | Authors: | Ong, M.S, Richmond, T.J, Davey, C.A. | | Deposit date: | 2006-11-23 | | Release date: | 2007-04-10 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (2.65 Å) | | Cite: | DNA stretching and extreme kinking in the nucleosome core
J.Mol.Biol., 368, 2007
|
|
1HIO
 | | HISTONE OCTAMER (CHICKEN), CHROMOSOMAL PROTEIN, ALPHA CARBONS ONLY | | Descriptor: | HISTONE H2A, HISTONE H2B, HISTONE H3, ... | | Authors: | Arents, G, Moudrianakis, E.N. | | Deposit date: | 1991-09-19 | | Release date: | 1998-11-25 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3.1 Å) | | Cite: | The nucleosomal core histone octamer at 3.1 A resolution: a tripartite protein assembly and a left-handed superhelix.
Proc.Natl.Acad.Sci.USA, 88, 1991
|
|
5MLU
 | | Crystal structure of the PFV GAG CBS bound to a mononucleosome | | Descriptor: | DNA (145-MER), Histone H2A type 1, Histone H2B, ... | | Authors: | Pye, V.E, Maskell, D.P, Lesbats, P, Cherepanov, P. | | Deposit date: | 2016-12-07 | | Release date: | 2017-05-10 | | Last modified: | 2024-01-17 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Structural basis for spumavirus GAG tethering to chromatin.
Proc. Natl. Acad. Sci. U.S.A., 114, 2017
|
|
2RVQ
 | | Solution structure of the isolated histone H2A-H2B heterodimer | | Descriptor: | Histone H2A type 1-B/E, Histone H2B type 1-J | | Authors: | Moriwaki, Y, Yamane, T, Ohtomo, H, Ikeguchi, M, Kurita, J, Sato, M, Nagadoi, A, Shimojo, H, Nishimura, Y. | | Deposit date: | 2016-03-28 | | Release date: | 2016-05-25 | | Last modified: | 2024-05-01 | | Method: | SOLUTION NMR | | Cite: | Solution structure of the isolated histone H2A-H2B heterodimer
Sci Rep, 6, 2016
|
|
8HY0
 | |
8HXX
 | | Cryo-EM structure of the histone deacetylase complex Rpd3S | | Descriptor: | Chromatin modification-related protein EAF3, Histone H3, Histone deacetylase RPD3, ... | | Authors: | Cui, H, Wang, H. | | Deposit date: | 2023-01-05 | | Release date: | 2023-09-27 | | Last modified: | 2024-11-06 | | Method: | ELECTRON MICROSCOPY (3 Å) | | Cite: | Structure of histone deacetylase complex Rpd3S bound to nucleosome.
Nat.Struct.Mol.Biol., 30, 2023
|
|
8HXY
 | |
