6PNM
| |
2LQW
| |
2YWK
| Crystal structure of RRM-domain derived from human putative RNA-binding protein 11 | Descriptor: | Putative RNA-binding protein 11 | Authors: | Kawazoe, M, Takemoto, C, Kaminishi, T, Uchikubo-Kamo, T, Nishino, A, Morita, S, Terada, T, Shirouzu, M, Yokoyama, S, RIKEN Structural Genomics/Proteomics Initiative (RSGI) | Deposit date: | 2007-04-20 | Release date: | 2008-04-22 | Last modified: | 2023-11-15 | Method: | X-RAY DIFFRACTION (1.54 Å) | Cite: | Crystal structure of RRM-domain derived from human putative RNA-binding protein 11 To be Published
|
|
1FKL
| ATOMIC STRUCTURE OF FKBP12-RAPAYMYCIN, AN IMMUNOPHILIN-IMMUNOSUPPRESSANT COMPLEX | Descriptor: | FK506 BINDING PROTEIN, RAPAMYCIN IMMUNOSUPPRESSANT DRUG | Authors: | Wilson, K.P, Sintchak, M.D, Thomson, J.A, Navia, M.A. | Deposit date: | 1995-08-18 | Release date: | 1995-12-07 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (1.7 Å) | Cite: | Comparative X-ray structures of the major binding protein for the immunosuppressant FK506 (tacrolimus) in unliganded form and in complex with FK506 and rapamycin. Acta Crystallogr.,Sect.D, 51, 1995
|
|
5HWY
| Structural mechanisms of extracellular ion exchange and induced binding-site occlusion in the sodium-calcium exchanger NCX_Mj soaked with 10 mM Na+ and zero Ca2+ | Descriptor: | (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, ACETATE ION, PENTADECANE, ... | Authors: | Liao, J, Jiang, Y.X, Faraldo-Gomez, J.D. | Deposit date: | 2016-01-29 | Release date: | 2016-05-18 | Last modified: | 2023-11-08 | Method: | X-RAY DIFFRACTION (2.098 Å) | Cite: | Mechanism of extracellular ion exchange and binding-site occlusion in a sodium/calcium exchanger Nat.Struct.Mol.Biol., 23, 2016
|
|
5HYA
| Structural mechanisms of extracellular ion exchange and induced binding-site occlusion in the sodium-calcium exchangerNCX_Mj soaked with 150 mM Na+ and nominal Ca2+ | Descriptor: | (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, ACETATE ION, CALCIUM ION, ... | Authors: | Liao, J, Jiang, Y.X, Faraldo-Gomez, J.D. | Deposit date: | 2016-02-01 | Release date: | 2016-05-11 | Last modified: | 2023-11-08 | Method: | X-RAY DIFFRACTION (1.897 Å) | Cite: | Mechanism of extracellular ion exchange and binding-site occlusion in a sodium/calcium exchanger Nat.Struct.Mol.Biol., 23, 2016
|
|
5HWX
| Structural mechanisms of extracellular ion exchange and induced binding-site occlusion in the sodium-calcium exchanger NCX_Mj soaked with 2.5 mM Na+ and zero Ca2+ | Descriptor: | CHLORIDE ION, DI(HYDROXYETHYL)ETHER, PENTADECANE, ... | Authors: | Liao, J, Jiang, Y.X, Faraldo-Gomez, J.D. | Deposit date: | 2016-01-29 | Release date: | 2016-05-11 | Last modified: | 2023-11-08 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Mechanism of extracellular ion exchange and binding-site occlusion in a sodium/calcium exchanger Nat.Struct.Mol.Biol., 23, 2016
|
|
5HXC
| Structural mechanisms of extracellular ion exchange and induced binding-site occlusion in the sodium-calcium exchanger NCX_Mj soaked with 20 mM Na+ and zero Ca2+ | Descriptor: | (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, 3,5,7-TRIHYDROXY-2-(3,4,5-TRIHYDROXYPHENYL)-4H-CHROMEN-4-ONE, CALCIUM ION, ... | Authors: | Liao, J, Jiang, Y.X, Faraldo-Gomez, J.D. | Deposit date: | 2016-01-30 | Release date: | 2016-05-11 | Last modified: | 2023-11-08 | Method: | X-RAY DIFFRACTION (2.101 Å) | Cite: | Mechanism of extracellular ion exchange and binding-site occlusion in a sodium/calcium exchanger Nat.Struct.Mol.Biol., 23, 2016
|
|
5HXE
| Structural mechanisms of extracellular ion exchange and induced binding-site occlusion in the sodium-calcium exchanger NCX_Mj soaked with 100 mM Na+ and zero Ca2+ | Descriptor: | (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, CHLORIDE ION, PENTADECANE, ... | Authors: | Liao, J, Jiang, Y.X, Faraldo-Gomez, J.D. | Deposit date: | 2016-01-30 | Release date: | 2016-05-11 | Last modified: | 2023-11-08 | Method: | X-RAY DIFFRACTION (2.288 Å) | Cite: | Mechanism of extracellular ion exchange and binding-site occlusion in a sodium/calcium exchanger Nat.Struct.Mol.Biol., 23, 2016
|
|
5HXS
| Structural mechanisms of extracellular ion exchange and induced binding-site occlusion in the sodium-calcium exchanger NCX_Mj soaked with 2.5 mM Na+ and 10mM Sr2+ | Descriptor: | (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, 2-[2-(2-METHOXY-ETHOXY)-ETHOXY]-ETHOXYL, PENTADECANE, ... | Authors: | Liao, J, Jiang, Y.X, Faraldo-Gomez, J.D. | Deposit date: | 2016-01-31 | Release date: | 2016-05-11 | Last modified: | 2023-11-08 | Method: | X-RAY DIFFRACTION (2.789 Å) | Cite: | Mechanism of extracellular ion exchange and binding-site occlusion in a sodium/calcium exchanger Nat.Struct.Mol.Biol., 23, 2016
|
|
5HXR
| Structural mechanisms of extracellular ion exchange and induced binding-site occlusion in the sodium-calcium exchanger NCX_Mj soaked with 2.5 mM Na+ and 10mM Ca2+ | Descriptor: | (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, CALCIUM ION, PENTADECANE, ... | Authors: | Liao, J, Jiang, Y.X, Faraldo-Gomez, J.D. | Deposit date: | 2016-01-31 | Release date: | 2016-05-11 | Last modified: | 2023-11-08 | Method: | X-RAY DIFFRACTION (2.463 Å) | Cite: | Mechanism of extracellular ion exchange and binding-site occlusion in a sodium/calcium exchanger Nat.Struct.Mol.Biol., 23, 2016
|
|
8K66
| Cryo-EM structure of Oryza sativa HKT2;1 at 2.5 angstrom | Descriptor: | 1,2-DIACYL-SN-GLYCERO-3-PHOSPHOCHOLINE, CHOLESTEROL, CHOLESTEROL HEMISUCCINATE, ... | Authors: | Wang, X, Shen, X, Qu, Y, Wang, C, Shen, H. | Deposit date: | 2023-07-25 | Release date: | 2024-04-03 | Last modified: | 2024-05-08 | Method: | ELECTRON MICROSCOPY (2.53 Å) | Cite: | Structural insights into ion selectivity and transport mechanisms of Oryza sativa HKT2;1 and HKT2;2/1 transporters. Nat.Plants, 10, 2024
|
|
5JDF
| Structural mechanisms of extracellular ion exchange and induced binding-site occlusion in the sodium-calcium exchanger NCX_Mj soaked with 2.5 mM Na+ and 1mM Ca2+ | Descriptor: | (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, CALCIUM ION, PENTADECANE, ... | Authors: | Liao, J, Jiang, Y.X, Faraldo-Gomez, J.D. | Deposit date: | 2016-04-16 | Release date: | 2016-05-11 | Last modified: | 2023-09-27 | Method: | X-RAY DIFFRACTION (2.65 Å) | Cite: | Mechanism of extracellular ion exchange and binding-site occlusion in a sodium/calcium exchanger. Nat.Struct.Mol.Biol., 23, 2016
|
|
5JDQ
| Structural mechanisms of extracellular ion exchange and induced binding-site occlusion in the sodium-calcium exchanger NCX_Mj soaked with 100 mM Na+ and 10mM Sr2+ | Descriptor: | (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, CHLORIDE ION, PENTADECANE, ... | Authors: | Liao, J, Jiang, Y.X, Faraldo-Gomez, J.D. | Deposit date: | 2016-04-17 | Release date: | 2016-05-11 | Last modified: | 2023-09-27 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | Mechanism of extracellular ion exchange and binding-site occlusion in a sodium/calcium exchanger. Nat.Struct.Mol.Biol., 23, 2016
|
|
5JDM
| Structural mechanisms of extracellular ion exchange and induced binding-site occlusion in the sodium-calcium exchanger NCX_Mj soaked with 2.5 mM Na+ and 0.1mM Sr2+ | Descriptor: | (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, 3,6,9,12,15-PENTAOXAHEPTADECANE, PENTADECANE, ... | Authors: | Liao, J, Jiang, Y.X, Faraldo-Gomez, J.D. | Deposit date: | 2016-04-17 | Release date: | 2016-05-11 | Last modified: | 2023-09-27 | Method: | X-RAY DIFFRACTION (2.558 Å) | Cite: | Mechanism of extracellular ion exchange and binding-site occlusion in a sodium/calcium exchanger. Nat.Struct.Mol.Biol., 23, 2016
|
|
5JDH
| Structural mechanisms of extracellular ion exchange and induced binding-site occlusion in the sodium-calcium exchanger NCX_Mj soaked with 10 mM Na+ and 10mM Ca2+ | Descriptor: | (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, 3,6,9,12,15,18,21-HEPTAOXATRICOSANE-1,23-DIOL, CALCIUM ION, ... | Authors: | Liao, J, Jiang, Y.X, Faraldo-Gomez, J.D. | Deposit date: | 2016-04-16 | Release date: | 2016-05-11 | Last modified: | 2023-09-27 | Method: | X-RAY DIFFRACTION (2.203 Å) | Cite: | Mechanism of extracellular ion exchange and binding-site occlusion in a sodium/calcium exchanger. Nat.Struct.Mol.Biol., 23, 2016
|
|
5JDN
| Structural mechanisms of extracellular ion exchange and induced binding-site occlusion in the sodium-calcium exchanger NCX_Mj soaked with 10 mM Na+ and 10mM Sr2+ | Descriptor: | (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, PENTADECANE, PENTAETHYLENE GLYCOL, ... | Authors: | Liao, J, Jiang, Y.X, Faraldo-Gomez, J.D. | Deposit date: | 2016-04-17 | Release date: | 2016-05-11 | Last modified: | 2023-09-27 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | Mechanism of extracellular ion exchange and binding-site occlusion in a sodium/calcium exchanger. Nat.Struct.Mol.Biol., 23, 2016
|
|
5JDG
| Structural mechanisms of extracellular ion exchange and induced binding-site occlusion in the sodium-calcium exchanger NCX_Mj soaked with 2.5 mM Na+ and 0.1mM Ca2+ | Descriptor: | (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, CALCIUM ION, DI(HYDROXYETHYL)ETHER, ... | Authors: | Liao, J, Jiang, Y.X, Faraldo-Gomez, J.D. | Deposit date: | 2016-04-16 | Release date: | 2016-05-11 | Last modified: | 2023-09-27 | Method: | X-RAY DIFFRACTION (2.407 Å) | Cite: | Mechanism of extracellular ion exchange and binding-site occlusion in a sodium/calcium exchanger. Nat.Struct.Mol.Biol., 23, 2016
|
|
5JDL
| Structural mechanisms of extracellular ion exchange and induced binding-site occlusion in the sodium-calcium exchanger NCX_Mj soaked with 2.5 mM Na+ and 1mM Sr2+ | Descriptor: | (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, CHLORIDE ION, PENTADECANE, ... | Authors: | Liao, J, Jiang, Y.X, Faraldo-Gomez, J.D. | Deposit date: | 2016-04-17 | Release date: | 2016-05-11 | Last modified: | 2023-09-27 | Method: | X-RAY DIFFRACTION (2.904 Å) | Cite: | Mechanism of extracellular ion exchange and binding-site occlusion in a sodium/calcium exchanger. Nat.Struct.Mol.Biol., 23, 2016
|
|
1KX3
| X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution | Descriptor: | DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3'), MANGANESE (II) ION, histone H2A.1, ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
1KX5
| X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution | Descriptor: | CHLORIDE ION, DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (1.94 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
5HXH
| Structural mechanisms of extracellular ion exchange and induced binding-site occlusion in the sodium-calcium exchanger NCX_Mj soaked with zero Na+ and Ca2+ | Descriptor: | (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, CALCIUM ION, PENTADECANE, ... | Authors: | Liao, J, Jiang, Y.X, Faraldo-Gomez, J.D. | Deposit date: | 2016-01-30 | Release date: | 2016-05-11 | Last modified: | 2023-11-08 | Method: | X-RAY DIFFRACTION (2.804 Å) | Cite: | Mechanism of extracellular ion exchange and binding-site occlusion in a sodium/calcium exchanger Nat.Struct.Mol.Biol., 23, 2016
|
|
1KX4
| X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution | Descriptor: | CHLORIDE ION, DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3'), MANGANESE (II) ION, ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
6GK4
| Human NBD1 of CFTR in complex with nanobodies D12 and T8 | Descriptor: | ADENOSINE-5'-TRIPHOSPHATE, Cystic fibrosis transmembrane conductance regulator, GLYCEROL, ... | Authors: | Sigoillot, M, Overtus, M, Grodecka, M, Scholl, D, Garcia-Pino, A, Laeremans, T, He, L, Pardon, E, Hildebrandt, E, Urbatsch, I, Steyaert, J, Riordan, J.R, Govaerts, C. | Deposit date: | 2018-05-18 | Release date: | 2019-06-19 | Last modified: | 2019-08-21 | Method: | X-RAY DIFFRACTION (2.91 Å) | Cite: | Domain-interface dynamics of CFTR revealed by stabilizing nanobodies. Nat Commun, 10, 2019
|
|
4IQZ
| The crystal structure of a large insert in RNA polymerase (RpoC) subunit from E. coli | Descriptor: | DNA-directed RNA polymerase subunit beta', IODIDE ION, SODIUM ION | Authors: | Bhandari, V, Sugiman-Marangos, S.N, Naushad, H.S, Gupta, R.S, Junop, M.S. | Deposit date: | 2013-01-14 | Release date: | 2013-02-13 | Method: | X-RAY DIFFRACTION (2.1 Å) | Cite: | The crystal structure of a large insert in RNA polymerase (RpoC) subunit from E. coli To be Published
|
|