1POG
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1pog by Molmil](/molmil-images/mine/1pog) | SOLUTION STRUCTURE OF THE OCT-1 POU-HOMEO DOMAIN DETERMINED BY NMR AND RESTRAINED MOLECULAR DYNAMICS | Descriptor: | OCT-1 POU HOMEODOMAIN DNA-BINDING PROTEIN | Authors: | Cox, M, Van Tilborg, P.J.A, De Laat, W, Boelens, R, Van Leeuwen, H.C, Van Der Vliet, P.C, Kaptein, R. | Deposit date: | 1994-10-12 | Release date: | 1995-07-31 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | Solution structure of the Oct-1 POU homeodomain determined by NMR and restrained molecular dynamics. J.Biomol.NMR, 6, 1995
|
|
1AZ3
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1az3 by Molmil](/molmil-images/mine/1az3) | ECORV ENDONUCLEASE, UNLIGANDED, FORM B | Descriptor: | ECORV ENDONUCLEASE | Authors: | Perona, J, Martin, A. | Deposit date: | 1997-11-24 | Release date: | 1998-05-27 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Conformational transitions and structural deformability of EcoRV endonuclease revealed by crystallographic analysis. J.Mol.Biol., 273, 1997
|
|
4NB3
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4nb3 by Molmil](/molmil-images/mine/4nb3) | Crystal structure of RPA70N in complex with a 3,4 dichlorophenylalanine ATRIP derived peptide | Descriptor: | 3,4 dichlorophenylalanine ATRIP derived peptide, Replication protein A 70 kDa DNA-binding subunit | Authors: | Feldkamp, M.D, Frank, A.O, Vangamudi, B, Souza-Fagundes, E.M, Luzwik, J.W, Cortez, D, Olejniczak, O.T, Waterson, A.G, Rossanese, O.W, Fesik, S.W, Chazin, W.J. | Deposit date: | 2013-10-22 | Release date: | 2014-02-26 | Last modified: | 2024-07-10 | Method: | X-RAY DIFFRACTION (1.35 Å) | Cite: | Discovery of a Potent Stapled Helix Peptide That Binds to the 70N Domain of Replication Protein A. J.Med.Chem., 57, 2014
|
|
1AZ4
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1az4 by Molmil](/molmil-images/mine/1az4) | ECORV ENDONUCLEASE, UNLIGANDED, FORM B, T93A MUTANT | Descriptor: | ECORV ENDONUCLEASE | Authors: | Perona, J, Martin, A. | Deposit date: | 1997-11-24 | Release date: | 1998-05-27 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Conformational transitions and structural deformability of EcoRV endonuclease revealed by crystallographic analysis. J.Mol.Biol., 273, 1997
|
|
2Q2E
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2q2e by Molmil](/molmil-images/mine/2q2e) | |
1VND
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1vnd by Molmil](/molmil-images/mine/1vnd) | VND/NK-2 PROTEIN (HOMEODOMAIN), NMR | Descriptor: | VND/NK-2 PROTEIN | Authors: | Tsao, D.H.H, Gruschus, J.M, Wang, L.-H, Nirenberg, M, Ferretti, J.A. | Deposit date: | 1996-05-22 | Release date: | 1996-11-08 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | The three-dimensional solution structure of the NK-2 homeodomain from Drosophila. J.Mol.Biol., 251, 1995
|
|
1S10
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1s10 by Molmil](/molmil-images/mine/1s10) | Snapshots of replication through an abasic lesion: structural basis for base substitution and frameshift | Descriptor: | 2'-DEOXYCYTIDINE-5'-TRIPHOSPHATE, 5'-D(*GP*GP*GP*GP*GP*AP*AP*GP*GP*AP*CP*TP*A)-3', 5'-D(*TP*CP*AP*GP*TP*AP*GP*TP*CP*CP*TP*TP*CP*CP*CP*CP*C)-3', ... | Authors: | Ling, H, Boudsocq, F, Woodgate, R, Yang, W. | Deposit date: | 2004-01-05 | Release date: | 2004-03-30 | Last modified: | 2023-08-23 | Method: | X-RAY DIFFRACTION (2.1 Å) | Cite: | Snapshots of Replication through an Abasic Lesion; Structural Basis for Base Substitutions and Frameshifts. Mol.Cell, 13, 2004
|
|
4LMG
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4lmg by Molmil](/molmil-images/mine/4lmg) | Crystal structure of AFT2 in complex with DNA | Descriptor: | 5'-D(*AP*AP*GP*TP*GP*CP*AP*CP*CP*CP*AP*TP*T)-3', 5'-D(*TP*AP*AP*TP*GP*GP*GP*TP*GP*CP*AP*CP*T)-3', Iron-regulated transcriptional activator AFT2, ... | Authors: | Poor, C.B, Sanishvili, R, Schuermann, J.P, He, C. | Deposit date: | 2013-07-10 | Release date: | 2014-03-05 | Last modified: | 2024-02-28 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | Molecular mechanism and structure of the Saccharomyces cerevisiae iron regulator Aft2. Proc.Natl.Acad.Sci.USA, 111, 2014
|
|
1S0N
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1s0n by Molmil](/molmil-images/mine/1s0n) | Snapshots of replication through an abasic lesion: structural basis for base substitution and frameshift | Descriptor: | 2'-DEOXYCYTIDINE-5'-TRIPHOSPHATE, 5'-D(*GP*GP*CP*AP*CP*TP*GP*AP*TP*CP*AP*CP*G)-3', 5'-D(*TP*AP*CP*GP*AP*CP*GP*TP*GP*AP*TP*CP*AP*GP*TP*GP*CP*C)-3', ... | Authors: | Ling, H, Boudsocq, F, Woodgate, R, Yang, W. | Deposit date: | 2003-12-31 | Release date: | 2004-03-30 | Last modified: | 2023-08-23 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | Snapshots of Replication through an Abasic Lesion; Structural Basis for Base Substitutions and Frameshifts. Mol.Cell, 13, 2004
|
|
6F07
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6f07 by Molmil](/molmil-images/mine/6f07) | CBF3 Core Complex | Descriptor: | Centromere DNA-binding protein complex CBF3 subunit B, Suppressor of kinetochore protein 1, ZINC ION | Authors: | Leber, V, Singleton, M.R. | Deposit date: | 2017-11-17 | Release date: | 2017-12-13 | Last modified: | 2019-12-11 | Method: | ELECTRON MICROSCOPY (3.6 Å) | Cite: | Structural basis for assembly of the CBF3 kinetochore complex. EMBO J., 37, 2018
|
|
1S0O
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1s0o by Molmil](/molmil-images/mine/1s0o) | Snapshots of replication through an abasic lesion: structural basis for base substitution and frameshift | Descriptor: | 5'-D(*GP*GP*GP*GP*GP*AP*AP*GP*GP*AP*CP*TP*C)-3', 5'-D(*TP*CP*AP*GP*TP*AP*GP*TP*CP*CP*TP*TP*CP*CP*CP*CP*C)-3', CALCIUM ION, ... | Authors: | Ling, H, Boudsocq, F, Woodgate, R, Yang, W. | Deposit date: | 2003-12-31 | Release date: | 2004-03-30 | Last modified: | 2023-08-23 | Method: | X-RAY DIFFRACTION (2.1 Å) | Cite: | Snapshots of Replication through an Abasic Lesion; Structural Basis for Base Substitutions and Frameshifts. Mol.Cell, 13, 2004
|
|
7TR9
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7tr9 by Molmil](/molmil-images/mine/7tr9) | Cascade complex from type I-A CRISPR-Cas system | Descriptor: | CRISPR-associated endonuclease Cas3-HD, CRISPR-associated helicase Cas3, Cas11a, ... | Authors: | Hu, C, Ni, D, Nam, K.H, Majumdar, S, McLean, J, Stahlberg, H, Terns, M, Ke, A. | Deposit date: | 2022-01-28 | Release date: | 2022-08-10 | Last modified: | 2022-08-24 | Method: | ELECTRON MICROSCOPY (3.9 Å) | Cite: | Allosteric control of type I-A CRISPR-Cas3 complexes and establishment as effective nucleic acid detection and human genome editing tools. Mol.Cell, 82, 2022
|
|
7A08
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7a08 by Molmil](/molmil-images/mine/7a08) | CryoEM Structure of cGAS Nucleosome complex | Descriptor: | Cyclic GMP-AMP synthase, Histone H2A type 1-C, Histone H2B type 1-C/E/F/G/I, ... | Authors: | Michalski, S, de Oliveira Mann, C.C, Witte, G, Bartho, J, Lammens, K, Hopfner, K.P. | Deposit date: | 2020-08-07 | Release date: | 2020-09-23 | Last modified: | 2021-02-10 | Method: | ELECTRON MICROSCOPY (3.11 Å) | Cite: | Structural basis for sequestration and autoinhibition of cGAS by chromatin. Nature, 587, 2020
|
|
4NB5
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4nb5 by Molmil](/molmil-images/mine/4nb5) | |
1ODD
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1odd by Molmil](/molmil-images/mine/1odd) | |
8OUZ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8ouz by Molmil](/molmil-images/mine/8ouz) | Human RAD51B-RAD51C-RAD51D-XRCC2 (BCDX2) complex, 2.2 A resolution | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, ADENOSINE-5'-TRIPHOSPHATE, DNA repair protein RAD51 homolog 2, ... | Authors: | Greenhough, L.A, Liang, C.C, West, S.C. | Deposit date: | 2023-04-25 | Release date: | 2023-06-21 | Last modified: | 2024-07-24 | Method: | ELECTRON MICROSCOPY (2.2 Å) | Cite: | Structure and function of the RAD51B-RAD51C-RAD51D-XRCC2 tumour suppressor. Nature, 619, 2023
|
|
1LFU
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1lfu by Molmil](/molmil-images/mine/1lfu) | NMR Solution Structure of the Extended PBX Homeodomain Bound to DNA | Descriptor: | 5'-D(*GP*CP*GP*CP*AP*TP*GP*AP*TP*TP*GP*CP*CP*C)-3', 5'-D(*GP*GP*GP*CP*AP*AP*TP*CP*AP*TP*GP*CP*GP*C)-3', homeobox protein PBX1 | Authors: | Sprules, T, Green, N, Featherstone, M, Gehring, K. | Deposit date: | 2002-04-12 | Release date: | 2003-01-14 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | Lock and Key Binding of the HOX YPWM Peptide to the PBX Homeodomain J.Biol.Chem., 278, 2003
|
|
1Y1W
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1y1w by Molmil](/molmil-images/mine/1y1w) | Complete RNA Polymerase II elongation complex | Descriptor: | 5'-D(*AP*AP*GP*TP*AP*CP*T)-3', 5'-D(P*AP*GP*TP*AP*CP*TP*TP*AP*CP*GP*CP*CP*TP*GP*GP*TP*CP*AP*T)-3', 5'-R(*AP*AP*GP*AP*CP*CP*AP*GP*GP*C)-3', ... | Authors: | Cramer, P, Kettenberger, H, Armache, K.-J. | Deposit date: | 2004-11-19 | Release date: | 2005-01-04 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (4 Å) | Cite: | Complete RNA Polymerase II Elongation Complex Structure and Its Interactions with NTP and TFIIS Mol.Cell, 16, 2004
|
|
1SAX
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1sax by Molmil](/molmil-images/mine/1sax) | Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA | Descriptor: | 5'-d(CAAAATTACAACTGTAATATCGGAG)-3', 5'-d(GCTCCGATATTACAGTTGTAATTTT)-3', Methicillin resistance regulatory protein mecI, ... | Authors: | Garcia-Castellanos, R, Mallorqui-Fernandez, G, Marrero, A, Potempa, J, Coll, M, Gomis-Ruth, F.X. | Deposit date: | 2004-02-09 | Release date: | 2004-04-27 | Last modified: | 2023-08-23 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | On the transcriptional regulation of methicillin resistance: MecI repressor in complex with its operator J.Biol.Chem., 279, 2004
|
|
2Z90
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2z90 by Molmil](/molmil-images/mine/2z90) | Crystal Structure of the Second Dps from Mycobacterium smegmatis | Descriptor: | CHLORIDE ION, FE (II) ION, MAGNESIUM ION, ... | Authors: | Roy, S, Saraswathi, R, Chatterji, D, Vijayan, M. | Deposit date: | 2007-09-13 | Release date: | 2008-04-22 | Last modified: | 2023-11-01 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Structural studies on the second Mycobacterium smegmatis Dps: invariant and variable features of structure, assembly and function. J.Mol.Biol., 375, 2008
|
|
8GYK
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8gyk by Molmil](/molmil-images/mine/8gyk) | CryoEM structure of the RAD51_ADP filament | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, DNA repair protein RAD51 homolog 1, MAGNESIUM ION | Authors: | Miki, Y, Luo, S.C, Ho, M.C. | Deposit date: | 2022-09-22 | Release date: | 2023-08-30 | Method: | ELECTRON MICROSCOPY (3.14 Å) | Cite: | A RAD51-ADP double filament structure unveils the mechanism of filament dynamics in homologous recombination. Nat Commun, 14, 2023
|
|
3QEX
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3qex by Molmil](/molmil-images/mine/3qex) | |
3QET
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3qet by Molmil](/molmil-images/mine/3qet) | |
3QEV
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3qev by Molmil](/molmil-images/mine/3qev) | |
6N3A
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6n3a by Molmil](/molmil-images/mine/6n3a) | SegA-long, conformation of TDP-43 low complexity domain segment A long | Descriptor: | TAR DNA-binding protein 43, segA long small | Authors: | Cao, Q, Boyer, D.R, Sawaya, M.R, Eisenberg, D.S. | Deposit date: | 2018-11-14 | Release date: | 2019-06-26 | Last modified: | 2024-03-20 | Method: | ELECTRON MICROSCOPY (3.3 Å) | Cite: | Cryo-EM structures of four polymorphic TDP-43 amyloid cores. Nat.Struct.Mol.Biol., 26, 2019
|
|