PDB: 2849 resultsInfo pagesStatus searchChemie searchBIRD

---

6PNM	Human GSTO1-1 complexed with 2-chloro-N-(4-chloro-3-(morpholinosulfonyl)phenyl)acetamide Descriptor: 2-chloro-N-{4-chloro-3-[(morpholin-4-yl)sulfonyl]phenyl}acetamide, Glutathione S-transferase omega-1, L(+)-TARTARIC ACID, ... Authors: Oakley, A.J. Deposit date: 2019-07-02 Release date: 2019-07-24 Last modified: 2023-10-11 Method: X-RAY DIFFRACTION (1.82 Å) Cite: Development of Benzenesulfonamide Derivatives as Potent Glutathione Transferase Omega-1 Inhibitors. J.Med.Chem., 63, 2020
2LQW	Solution structure of phosphorylated CRKL Descriptor: Crk-like protein Authors: Jankowski, W, Saleh, T, Kalodimos, C. Deposit date: 2012-03-16 Release date: 2012-05-16 Last modified: 2023-06-14 Method: SOLUTION NMR Cite: Domain organization differences explain Bcr-Abl's preference for CrkL over CrkII. Nat.Chem.Biol., 8, 2012
2YWK	Crystal structure of RRM-domain derived from human putative RNA-binding protein 11 Descriptor: Putative RNA-binding protein 11 Authors: Kawazoe, M, Takemoto, C, Kaminishi, T, Uchikubo-Kamo, T, Nishino, A, Morita, S, Terada, T, Shirouzu, M, Yokoyama, S, RIKEN Structural Genomics/Proteomics Initiative (RSGI) Deposit date: 2007-04-20 Release date: 2008-04-22 Last modified: 2023-11-15 Method: X-RAY DIFFRACTION (1.54 Å) Cite: Crystal structure of RRM-domain derived from human putative RNA-binding protein 11 To be Published
1FKL	ATOMIC STRUCTURE OF FKBP12-RAPAYMYCIN, AN IMMUNOPHILIN-IMMUNOSUPPRESSANT COMPLEX Descriptor: FK506 BINDING PROTEIN, RAPAMYCIN IMMUNOSUPPRESSANT DRUG Authors: Wilson, K.P, Sintchak, M.D, Thomson, J.A, Navia, M.A. Deposit date: 1995-08-18 Release date: 1995-12-07 Last modified: 2024-02-07 Method: X-RAY DIFFRACTION (1.7 Å) Cite: Comparative X-ray structures of the major binding protein for the immunosuppressant FK506 (tacrolimus) in unliganded form and in complex with FK506 and rapamycin. Acta Crystallogr.,Sect.D, 51, 1995
5HWY	Structural mechanisms of extracellular ion exchange and induced binding-site occlusion in the sodium-calcium exchanger NCX_Mj soaked with 10 mM Na+ and zero Ca2+ Descriptor: (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, ACETATE ION, PENTADECANE, ... Authors: Liao, J, Jiang, Y.X, Faraldo-Gomez, J.D. Deposit date: 2016-01-29 Release date: 2016-05-18 Last modified: 2023-11-08 Method: X-RAY DIFFRACTION (2.098 Å) Cite: Mechanism of extracellular ion exchange and binding-site occlusion in a sodium/calcium exchanger Nat.Struct.Mol.Biol., 23, 2016
5HYA	Structural mechanisms of extracellular ion exchange and induced binding-site occlusion in the sodium-calcium exchangerNCX_Mj soaked with 150 mM Na+ and nominal Ca2+ Descriptor: (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, ACETATE ION, CALCIUM ION, ... Authors: Liao, J, Jiang, Y.X, Faraldo-Gomez, J.D. Deposit date: 2016-02-01 Release date: 2016-05-11 Last modified: 2023-11-08 Method: X-RAY DIFFRACTION (1.897 Å) Cite: Mechanism of extracellular ion exchange and binding-site occlusion in a sodium/calcium exchanger Nat.Struct.Mol.Biol., 23, 2016
5HWX	Structural mechanisms of extracellular ion exchange and induced binding-site occlusion in the sodium-calcium exchanger NCX_Mj soaked with 2.5 mM Na+ and zero Ca2+ Descriptor: CHLORIDE ION, DI(HYDROXYETHYL)ETHER, PENTADECANE, ... Authors: Liao, J, Jiang, Y.X, Faraldo-Gomez, J.D. Deposit date: 2016-01-29 Release date: 2016-05-11 Last modified: 2023-11-08 Method: X-RAY DIFFRACTION (2.4 Å) Cite: Mechanism of extracellular ion exchange and binding-site occlusion in a sodium/calcium exchanger Nat.Struct.Mol.Biol., 23, 2016
5HXC	Structural mechanisms of extracellular ion exchange and induced binding-site occlusion in the sodium-calcium exchanger NCX_Mj soaked with 20 mM Na+ and zero Ca2+ Descriptor: (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, 3,5,7-TRIHYDROXY-2-(3,4,5-TRIHYDROXYPHENYL)-4H-CHROMEN-4-ONE, CALCIUM ION, ... Authors: Liao, J, Jiang, Y.X, Faraldo-Gomez, J.D. Deposit date: 2016-01-30 Release date: 2016-05-11 Last modified: 2023-11-08 Method: X-RAY DIFFRACTION (2.101 Å) Cite: Mechanism of extracellular ion exchange and binding-site occlusion in a sodium/calcium exchanger Nat.Struct.Mol.Biol., 23, 2016
5HXE	Structural mechanisms of extracellular ion exchange and induced binding-site occlusion in the sodium-calcium exchanger NCX_Mj soaked with 100 mM Na+ and zero Ca2+ Descriptor: (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, CHLORIDE ION, PENTADECANE, ... Authors: Liao, J, Jiang, Y.X, Faraldo-Gomez, J.D. Deposit date: 2016-01-30 Release date: 2016-05-11 Last modified: 2023-11-08 Method: X-RAY DIFFRACTION (2.288 Å) Cite: Mechanism of extracellular ion exchange and binding-site occlusion in a sodium/calcium exchanger Nat.Struct.Mol.Biol., 23, 2016
5HXS	Structural mechanisms of extracellular ion exchange and induced binding-site occlusion in the sodium-calcium exchanger NCX_Mj soaked with 2.5 mM Na+ and 10mM Sr2+ Descriptor: (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, 2-[2-(2-METHOXY-ETHOXY)-ETHOXY]-ETHOXYL, PENTADECANE, ... Authors: Liao, J, Jiang, Y.X, Faraldo-Gomez, J.D. Deposit date: 2016-01-31 Release date: 2016-05-11 Last modified: 2023-11-08 Method: X-RAY DIFFRACTION (2.789 Å) Cite: Mechanism of extracellular ion exchange and binding-site occlusion in a sodium/calcium exchanger Nat.Struct.Mol.Biol., 23, 2016
5HXR	Structural mechanisms of extracellular ion exchange and induced binding-site occlusion in the sodium-calcium exchanger NCX_Mj soaked with 2.5 mM Na+ and 10mM Ca2+ Descriptor: (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, CALCIUM ION, PENTADECANE, ... Authors: Liao, J, Jiang, Y.X, Faraldo-Gomez, J.D. Deposit date: 2016-01-31 Release date: 2016-05-11 Last modified: 2023-11-08 Method: X-RAY DIFFRACTION (2.463 Å) Cite: Mechanism of extracellular ion exchange and binding-site occlusion in a sodium/calcium exchanger Nat.Struct.Mol.Biol., 23, 2016
8K66	Cryo-EM structure of Oryza sativa HKT2;1 at 2.5 angstrom Descriptor: 1,2-DIACYL-SN-GLYCERO-3-PHOSPHOCHOLINE, CHOLESTEROL, CHOLESTEROL HEMISUCCINATE, ... Authors: Wang, X, Shen, X, Qu, Y, Wang, C, Shen, H. Deposit date: 2023-07-25 Release date: 2024-04-03 Last modified: 2024-05-08 Method: ELECTRON MICROSCOPY (2.53 Å) Cite: Structural insights into ion selectivity and transport mechanisms of Oryza sativa HKT2;1 and HKT2;2/1 transporters. Nat.Plants, 10, 2024
5JDF	Structural mechanisms of extracellular ion exchange and induced binding-site occlusion in the sodium-calcium exchanger NCX_Mj soaked with 2.5 mM Na+ and 1mM Ca2+ Descriptor: (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, CALCIUM ION, PENTADECANE, ... Authors: Liao, J, Jiang, Y.X, Faraldo-Gomez, J.D. Deposit date: 2016-04-16 Release date: 2016-05-11 Last modified: 2023-09-27 Method: X-RAY DIFFRACTION (2.65 Å) Cite: Mechanism of extracellular ion exchange and binding-site occlusion in a sodium/calcium exchanger. Nat.Struct.Mol.Biol., 23, 2016
5JDQ	Structural mechanisms of extracellular ion exchange and induced binding-site occlusion in the sodium-calcium exchanger NCX_Mj soaked with 100 mM Na+ and 10mM Sr2+ Descriptor: (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, CHLORIDE ION, PENTADECANE, ... Authors: Liao, J, Jiang, Y.X, Faraldo-Gomez, J.D. Deposit date: 2016-04-17 Release date: 2016-05-11 Last modified: 2023-09-27 Method: X-RAY DIFFRACTION (2.5 Å) Cite: Mechanism of extracellular ion exchange and binding-site occlusion in a sodium/calcium exchanger. Nat.Struct.Mol.Biol., 23, 2016
5JDM	Structural mechanisms of extracellular ion exchange and induced binding-site occlusion in the sodium-calcium exchanger NCX_Mj soaked with 2.5 mM Na+ and 0.1mM Sr2+ Descriptor: (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, 3,6,9,12,15-PENTAOXAHEPTADECANE, PENTADECANE, ... Authors: Liao, J, Jiang, Y.X, Faraldo-Gomez, J.D. Deposit date: 2016-04-17 Release date: 2016-05-11 Last modified: 2023-09-27 Method: X-RAY DIFFRACTION (2.558 Å) Cite: Mechanism of extracellular ion exchange and binding-site occlusion in a sodium/calcium exchanger. Nat.Struct.Mol.Biol., 23, 2016
5JDH	Structural mechanisms of extracellular ion exchange and induced binding-site occlusion in the sodium-calcium exchanger NCX_Mj soaked with 10 mM Na+ and 10mM Ca2+ Descriptor: (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, 3,6,9,12,15,18,21-HEPTAOXATRICOSANE-1,23-DIOL, CALCIUM ION, ... Authors: Liao, J, Jiang, Y.X, Faraldo-Gomez, J.D. Deposit date: 2016-04-16 Release date: 2016-05-11 Last modified: 2023-09-27 Method: X-RAY DIFFRACTION (2.203 Å) Cite: Mechanism of extracellular ion exchange and binding-site occlusion in a sodium/calcium exchanger. Nat.Struct.Mol.Biol., 23, 2016
5JDN	Structural mechanisms of extracellular ion exchange and induced binding-site occlusion in the sodium-calcium exchanger NCX_Mj soaked with 10 mM Na+ and 10mM Sr2+ Descriptor: (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, PENTADECANE, PENTAETHYLENE GLYCOL, ... Authors: Liao, J, Jiang, Y.X, Faraldo-Gomez, J.D. Deposit date: 2016-04-17 Release date: 2016-05-11 Last modified: 2023-09-27 Method: X-RAY DIFFRACTION (2.3 Å) Cite: Mechanism of extracellular ion exchange and binding-site occlusion in a sodium/calcium exchanger. Nat.Struct.Mol.Biol., 23, 2016
5JDG	Structural mechanisms of extracellular ion exchange and induced binding-site occlusion in the sodium-calcium exchanger NCX_Mj soaked with 2.5 mM Na+ and 0.1mM Ca2+ Descriptor: (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, CALCIUM ION, DI(HYDROXYETHYL)ETHER, ... Authors: Liao, J, Jiang, Y.X, Faraldo-Gomez, J.D. Deposit date: 2016-04-16 Release date: 2016-05-11 Last modified: 2023-09-27 Method: X-RAY DIFFRACTION (2.407 Å) Cite: Mechanism of extracellular ion exchange and binding-site occlusion in a sodium/calcium exchanger. Nat.Struct.Mol.Biol., 23, 2016
5JDL	Structural mechanisms of extracellular ion exchange and induced binding-site occlusion in the sodium-calcium exchanger NCX_Mj soaked with 2.5 mM Na+ and 1mM Sr2+ Descriptor: (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, CHLORIDE ION, PENTADECANE, ... Authors: Liao, J, Jiang, Y.X, Faraldo-Gomez, J.D. Deposit date: 2016-04-17 Release date: 2016-05-11 Last modified: 2023-09-27 Method: X-RAY DIFFRACTION (2.904 Å) Cite: Mechanism of extracellular ion exchange and binding-site occlusion in a sodium/calcium exchanger. Nat.Struct.Mol.Biol., 23, 2016
1KX3	X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution Descriptor: DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3'), MANGANESE (II) ION, histone H2A.1, ... Authors: Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. Deposit date: 2002-01-31 Release date: 2002-12-25 Last modified: 2023-08-16 Method: X-RAY DIFFRACTION (2 Å) Cite: Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
1KX5	X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution Descriptor: CHLORIDE ION, DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), ... Authors: Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. Deposit date: 2002-01-31 Release date: 2002-12-25 Last modified: 2023-08-16 Method: X-RAY DIFFRACTION (1.94 Å) Cite: Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
5HXH	Structural mechanisms of extracellular ion exchange and induced binding-site occlusion in the sodium-calcium exchanger NCX_Mj soaked with zero Na+ and Ca2+ Descriptor: (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, CALCIUM ION, PENTADECANE, ... Authors: Liao, J, Jiang, Y.X, Faraldo-Gomez, J.D. Deposit date: 2016-01-30 Release date: 2016-05-11 Last modified: 2023-11-08 Method: X-RAY DIFFRACTION (2.804 Å) Cite: Mechanism of extracellular ion exchange and binding-site occlusion in a sodium/calcium exchanger Nat.Struct.Mol.Biol., 23, 2016
1KX4	X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution Descriptor: CHLORIDE ION, DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3'), MANGANESE (II) ION, ... Authors: Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. Deposit date: 2002-01-31 Release date: 2002-12-25 Last modified: 2023-08-16 Method: X-RAY DIFFRACTION (2.6 Å) Cite: Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
6GK4	Human NBD1 of CFTR in complex with nanobodies D12 and T8 Descriptor: ADENOSINE-5'-TRIPHOSPHATE, Cystic fibrosis transmembrane conductance regulator, GLYCEROL, ... Authors: Sigoillot, M, Overtus, M, Grodecka, M, Scholl, D, Garcia-Pino, A, Laeremans, T, He, L, Pardon, E, Hildebrandt, E, Urbatsch, I, Steyaert, J, Riordan, J.R, Govaerts, C. Deposit date: 2018-05-18 Release date: 2019-06-19 Last modified: 2019-08-21 Method: X-RAY DIFFRACTION (2.91 Å) Cite: Domain-interface dynamics of CFTR revealed by stabilizing nanobodies. Nat Commun, 10, 2019
4IQZ	The crystal structure of a large insert in RNA polymerase (RpoC) subunit from E. coli Descriptor: DNA-directed RNA polymerase subunit beta', IODIDE ION, SODIUM ION Authors: Bhandari, V, Sugiman-Marangos, S.N, Naushad, H.S, Gupta, R.S, Junop, M.S. Deposit date: 2013-01-14 Release date: 2013-02-13 Method: X-RAY DIFFRACTION (2.1 Å) Cite: The crystal structure of a large insert in RNA polymerase (RpoC) subunit from E. coli To be Published

<949596979899100101102103104105106107108109>