3QEV
 
 | |
5FHH
 | | Structure of human Pif1 helicase domain residues 200-641 | | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, ATP-dependent DNA helicase PIF1, TETRAFLUOROALUMINATE ION | | Authors: | Zhou, X, Ren, W, Bharath, S.R, Song, H. | | Deposit date: | 2015-12-22 | | Release date: | 2016-03-30 | | Method: | X-RAY DIFFRACTION (3.6 Å) | | Cite: | Structural and Functional Insights into the Unwinding Mechanism of Bacteroides sp Pif1
Cell Rep, 14, 2016
|
|
1Y77
 | | Complete RNA Polymerase II elongation complex with substrate analogue GMPCPP | | Descriptor: | 5'-D(*AP*AP*GP*TP*AP*CP*T)-3', 5'-D(P*AP*GP*TP*AP*CP*TP*TP*AP*CP*T*CP*GP*CP*CP*TP*GP*GP*TP*CP*TP*G)-3', 5'-R(*AP*AP*GP*AP*CP*CP*AP*GP*GP*C)-3', ... | | Authors: | Kettenberger, H, Armache, K.-J, Cramer, P. | | Deposit date: | 2004-12-08 | | Release date: | 2005-01-04 | | Last modified: | 2023-10-25 | | Method: | X-RAY DIFFRACTION (4.5 Å) | | Cite: | Complete RNA Polymerase II Elongation Complex Structure and Its Interactions with NTP and TFIIS
Mol.Cell, 16, 2004
|
|
1SAX
 | | Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA | | Descriptor: | 5'-d(CAAAATTACAACTGTAATATCGGAG)-3', 5'-d(GCTCCGATATTACAGTTGTAATTTT)-3', Methicillin resistance regulatory protein mecI, ... | | Authors: | Garcia-Castellanos, R, Mallorqui-Fernandez, G, Marrero, A, Potempa, J, Coll, M, Gomis-Ruth, F.X. | | Deposit date: | 2004-02-09 | | Release date: | 2004-04-27 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | On the transcriptional regulation of methicillin resistance: MecI repressor in complex with its operator
J.Biol.Chem., 279, 2004
|
|
4LMG
 | | Crystal structure of AFT2 in complex with DNA | | Descriptor: | 5'-D(*AP*AP*GP*TP*GP*CP*AP*CP*CP*CP*AP*TP*T)-3', 5'-D(*TP*AP*AP*TP*GP*GP*GP*TP*GP*CP*AP*CP*T)-3', Iron-regulated transcriptional activator AFT2, ... | | Authors: | Poor, C.B, Sanishvili, R, Schuermann, J.P, He, C. | | Deposit date: | 2013-07-10 | | Release date: | 2014-03-05 | | Last modified: | 2024-02-28 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Molecular mechanism and structure of the Saccharomyces cerevisiae iron regulator Aft2.
Proc.Natl.Acad.Sci.USA, 111, 2014
|
|
4HTU
 | | Structure of 5-chlorouracil modified A:U base pair | | Descriptor: | 1,2-ETHANEDIOL, DNA (5'-D(*CP*GP*CP*GP*AP*AP*TP*(UCL)P*CP*GP*CP*G)-3'), GLYCEROL, ... | | Authors: | Patra, A, Egli, M. | | Deposit date: | 2012-11-01 | | Release date: | 2012-12-19 | | Last modified: | 2023-09-20 | | Method: | X-RAY DIFFRACTION (1.489 Å) | | Cite: | Structure, stability and function of 5-chlorouracil modified A:U and G:U base pairs.
Nucleic Acids Res., 41, 2013
|
|
1LFU
 | | NMR Solution Structure of the Extended PBX Homeodomain Bound to DNA | | Descriptor: | 5'-D(*GP*CP*GP*CP*AP*TP*GP*AP*TP*TP*GP*CP*CP*C)-3', 5'-D(*GP*GP*GP*CP*AP*AP*TP*CP*AP*TP*GP*CP*GP*C)-3', homeobox protein PBX1 | | Authors: | Sprules, T, Green, N, Featherstone, M, Gehring, K. | | Deposit date: | 2002-04-12 | | Release date: | 2003-01-14 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | Lock and Key Binding of the HOX YPWM Peptide to the PBX Homeodomain
J.Biol.Chem., 278, 2003
|
|
3QEW
 | |
4A09
 | | Structure of hsDDB1-drDDB2 bound to a 15 bp CPD-duplex (purine at D-1 position) at 3.1 A resolution (CPD 2) | | Descriptor: | 5'-D(*CP*CP*TP*GP*CP*TP*CP*CP*TP*TP*TP*CP*AP*CP*CP*C)-3', 5'-D(*GP*GP*TP*GP*AP*AP*AP*(TTD)P*AP*GP*CP*AP*GP*GP)-3', CALCIUM ION, ... | | Authors: | Scrima, A, Fischer, E.S, Iwai, S, Gut, H, Thoma, N.H. | | Deposit date: | 2011-09-08 | | Release date: | 2011-11-30 | | Last modified: | 2023-12-20 | | Method: | X-RAY DIFFRACTION (3.1 Å) | | Cite: | The Molecular Basis of Crl4(Ddb2/Csa) Ubiquitin Ligase Architecture, Targeting, and Activation
Cell(Cambridge,Mass.), 147, 2011
|
|
5JKT
 | | vaccinia virus D4 P173G mutant /A20(1-50) | | Descriptor: | ACETATE ION, DNA polymerase processivity factor component A20, SULFATE ION, ... | | Authors: | Contesto-Richefeu, C, Tarbouriech, N, Brazzolotto, X, Burmeister, W.P, Peyrefitte, C.N, Iseni, F. | | Deposit date: | 2016-04-26 | | Release date: | 2016-09-14 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (2.49 Å) | | Cite: | Structural analysis of point mutations at the Vaccinia virus A20/D4 interface.
Acta Crystallogr.,Sect.F, 72, 2016
|
|
7S8D
 | | Structure of DNA-free SgrAI | | Descriptor: | CALCIUM ION, SgraIR restriction enzyme | | Authors: | Horton, N.C. | | Deposit date: | 2021-09-17 | | Release date: | 2022-08-24 | | Last modified: | 2023-10-18 | | Method: | X-RAY DIFFRACTION (2.02 Å) | | Cite: | Pretransition state and apo structures of the filament-forming enzyme SgrAI elucidate mechanisms of activation and substrate specificity.
J.Biol.Chem., 298, 2022
|
|
6N3A
 | | SegA-long, conformation of TDP-43 low complexity domain segment A long | | Descriptor: | TAR DNA-binding protein 43, segA long small | | Authors: | Cao, Q, Boyer, D.R, Sawaya, M.R, Eisenberg, D.S. | | Deposit date: | 2018-11-14 | | Release date: | 2019-06-26 | | Last modified: | 2024-03-20 | | Method: | ELECTRON MICROSCOPY (3.3 Å) | | Cite: | Cryo-EM structures of four polymorphic TDP-43 amyloid cores.
Nat.Struct.Mol.Biol., 26, 2019
|
|
6N3C
 | | SegB, conformation of TDP-43 low complexity domain segment A | | Descriptor: | TAR DNA-binding protein 43 | | Authors: | Cao, Q, Boyer, D.R, Sawaya, M.R, Eisenberg, D.S. | | Deposit date: | 2018-11-14 | | Release date: | 2019-06-26 | | Last modified: | 2024-03-20 | | Method: | ELECTRON MICROSCOPY (3.3 Å) | | Cite: | Cryo-EM structures of four polymorphic TDP-43 amyloid cores.
Nat.Struct.Mol.Biol., 26, 2019
|
|
6N3B
 | | SegA-asym, conformation of TDP-43 low complexity domain segment A asym | | Descriptor: | TAR DNA-binding protein 43 | | Authors: | Cao, Q, Boyer, D.R, Sawaya, M.R, Eisenberg, D.S. | | Deposit date: | 2018-11-14 | | Release date: | 2019-06-26 | | Last modified: | 2024-03-20 | | Method: | ELECTRON MICROSCOPY (3.8 Å) | | Cite: | Cryo-EM structures of four polymorphic TDP-43 amyloid cores.
Nat.Struct.Mol.Biol., 26, 2019
|
|
6O2L
 | |
6J9C
 | | Crystal structure of Arabidopsis thaliana transcription factor LEC2-DNA complex | | Descriptor: | B3 domain-containing transcription factor LEC2, DNA (5'-D(*CP*AP*AP*TP*CP*CP*AP*TP*GP*CP*AP*GP*AP*AP*T)-3'), DNA (5'-D(*GP*AP*TP*TP*CP*TP*GP*CP*AP*TP*GP*GP*AP*TP*T)-3') | | Authors: | Hu, H, Du, J. | | Deposit date: | 2019-01-22 | | Release date: | 2019-05-29 | | Last modified: | 2023-11-22 | | Method: | X-RAY DIFFRACTION (3.102 Å) | | Cite: | Embryonic resetting of the parental vernalized state by two B3 domain transcription factors in Arabidopsis.
Nat.Plants, 5, 2019
|
|
6J9B
 | | Arabidopsis FUS3-DNA complex | | Descriptor: | B3 domain-containing transcription factor FUS3, DNA (5'-D(*AP*AP*TP*CP*CP*AP*TP*GP*CP*AP*GP*AP*AP*TP*C)-3'), DNA (5'-D(*AP*TP*TP*CP*TP*GP*CP*AP*TP*GP*GP*AP*TP*TP*G)-3') | | Authors: | Hu, H, Du, J. | | Deposit date: | 2019-01-22 | | Release date: | 2019-05-29 | | Last modified: | 2023-11-22 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | Embryonic resetting of the parental vernalized state by two B3 domain transcription factors in Arabidopsis.
Nat.Plants, 5, 2019
|
|
1T2T
 | | Crystal structure of the DNA-binding domain of intron endonuclease I-TevI with operator site | | Descriptor: | 5'-D(*AP*AP*TP*TP*AP*AP*AP*GP*GP*GP*CP*AP*GP*TP*CP*CP*TP*AP*CP*AP*A)-3', 5'-D(*TP*TP*TP*GP*TP*AP*GP*GP*AP*CP*TP*GP*CP*CP*CP*TP*TP*TP*AP*AP*T)-3', Intron-associated endonuclease 1, ... | | Authors: | Edgell, D.R, Derbyshire, V, Van Roey, P, LaBonne, S, Stanger, M.J, Li, Z, Boyd, T.M, Shub, D.A, Belfort, M. | | Deposit date: | 2004-04-22 | | Release date: | 2004-09-07 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (2.5 Å) | | Cite: | Intron-encoded homing endonuclease I-TevI also functions as a transcriptional autorepressor.
Nat.Struct.Mol.Biol., 11, 2004
|
|
3Q1M
 | | Crystal Structure of BmrR Dimer bound to DNA and the ligand 4-amino-quinaldine | | Descriptor: | 2-methylquinolin-4-amine, 23 bp promoter DNA, Multidrug-efflux transporter 1 regulator | | Authors: | Bachas, S, Eginton, C, Gunio, G, Wade, H. | | Deposit date: | 2010-12-17 | | Release date: | 2011-06-15 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | Structural contributions to multidrug recognition in the multidrug resistance (MDR) gene regulator, BmrR.
Proc.Natl.Acad.Sci.USA, 108, 2011
|
|
7C0M
 | | Human cGAS-nucleosome complex | | Descriptor: | Cyclic GMP-AMP synthase, DNA (145-MER), Histone H2A type 1-B/E, ... | | Authors: | Kujirai, T, Zierhut, C, Takizawa, Y, Kim, R, Negishi, L, Uruma, N, Hirai, S, Funabiki, H, Kurumizaka, H. | | Deposit date: | 2020-05-01 | | Release date: | 2020-09-16 | | Last modified: | 2024-03-27 | | Method: | ELECTRON MICROSCOPY (3.9 Å) | | Cite: | Structural basis for the inhibition of cGAS by nucleosomes.
Science, 370, 2020
|
|
7F25
 | |
8OUY
 | | Human RAD51B-RAD51C-RAD51D-XRCC2 (BCDX2) complex, 3.4 A resolution | | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, ADENOSINE-5'-TRIPHOSPHATE, DNA repair protein RAD51 homolog 2, ... | | Authors: | Greenhough, L.A, Liang, C.C, West, S.C. | | Deposit date: | 2023-04-25 | | Release date: | 2023-06-21 | | Last modified: | 2024-07-24 | | Method: | ELECTRON MICROSCOPY (3.4 Å) | | Cite: | Structure and function of the RAD51B-RAD51C-RAD51D-XRCC2 tumour suppressor.
Nature, 619, 2023
|
|
4Q47
 | |
1P6R
 | | Solution structure of the DNA binding domain of the repressor BlaI. | | Descriptor: | Penicillinase repressor | | Authors: | Melckebeke, H.V, Vreuls, C, Gans, P, Llabres, G, Filee, P, Joris, B, Simorre, J.P. | | Deposit date: | 2003-04-30 | | Release date: | 2003-12-09 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | Solution structural study of BlaI: implications for the repression of genes involved in beta-lactam antibiotic resistance.
J.Mol.Biol., 333, 2003
|
|
6ZUE
 | |
