3JC5
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3jc5 by Molmil](/molmil-images/mine/3jc5) | Structure of the eukaryotic replicative CMG helicase and pumpjack motion | Descriptor: | Cell division control protein 45, DNA replication complex GINS protein PSF1, DNA replication complex GINS protein PSF2, ... | Authors: | Li, H, Bai, L, Yuan, Z, Sun, J, Georgescu, R.E, Liu, J, O'Donnell, M.E. | Deposit date: | 2015-11-24 | Release date: | 2016-02-10 | Last modified: | 2018-07-18 | Method: | ELECTRON MICROSCOPY (4.7 Å) | Cite: | Structure of the eukaryotic replicative CMG helicase suggests a pumpjack motion for translocation. Nat.Struct.Mol.Biol., 23, 2016
|
|
7CCR
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7ccr by Molmil](/molmil-images/mine/7ccr) | Structure of the 2:2 cGAS-nucleosome complex | Descriptor: | Cyclic GMP-AMP synthase, DNA (147-MER), Histone H2A type 1-B/E, ... | Authors: | Cao, D, Han, X, Fan, X, Xu, R.M, Zhang, X. | Deposit date: | 2020-06-17 | Release date: | 2020-10-07 | Last modified: | 2024-03-27 | Method: | ELECTRON MICROSCOPY (4.9 Å) | Cite: | Structural basis for nucleosome-mediated inhibition of cGAS activity. Cell Res., 30, 2020
|
|
7CCQ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7ccq by Molmil](/molmil-images/mine/7ccq) | Structure of the 1:1 cGAS-nucleosome complex | Descriptor: | Cyclic GMP-AMP synthase, DNA (147-MER), Histone H2A type 1-B/E, ... | Authors: | Cao, D, Han, X, Fan, X, Xu, R.M, Zhang, X. | Deposit date: | 2020-06-17 | Release date: | 2020-10-07 | Last modified: | 2024-03-27 | Method: | ELECTRON MICROSCOPY (3.8 Å) | Cite: | Structural basis for nucleosome-mediated inhibition of cGAS activity. Cell Res., 30, 2020
|
|
3JC6
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3jc6 by Molmil](/molmil-images/mine/3jc6) | Structure of the eukaryotic replicative CMG helicase and pumpjack motion | Descriptor: | Cell division control protein 45, DNA replication complex GINS protein PSF1, DNA replication complex GINS protein PSF2, ... | Authors: | Li, H, Bai, L, Yuan, Z, Sun, J, Georgescu, R.E, Liu, J, O'Donnell, M.E. | Deposit date: | 2015-11-24 | Release date: | 2016-02-10 | Last modified: | 2018-07-18 | Method: | ELECTRON MICROSCOPY (3.7 Å) | Cite: | Structure of the eukaryotic replicative CMG helicase suggests a pumpjack motion for translocation. Nat.Struct.Mol.Biol., 23, 2016
|
|
5D1J
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5d1j by Molmil](/molmil-images/mine/5d1j) | |
7Z7E
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7z7e by Molmil](/molmil-images/mine/7z7e) | Crystal structure of p63 DNA binding domain in complex with inhibitory DARPin G4 | Descriptor: | DARPIN, Isoform 4 of Tumor protein 63, ZINC ION | Authors: | Strubel, A, Gebel, J, Chaikuad, A, Muenick, P, Doetsch, V. | Deposit date: | 2022-03-15 | Release date: | 2022-06-29 | Last modified: | 2024-01-31 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | Designed Ankyrin Repeat Proteins as a tool box for analyzing p63. Cell Death Differ., 29, 2022
|
|
4GOM
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4gom by Molmil](/molmil-images/mine/4gom) | |
7C0M
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7c0m by Molmil](/molmil-images/mine/7c0m) | Human cGAS-nucleosome complex | Descriptor: | Cyclic GMP-AMP synthase, DNA (145-MER), Histone H2A type 1-B/E, ... | Authors: | Kujirai, T, Zierhut, C, Takizawa, Y, Kim, R, Negishi, L, Uruma, N, Hirai, S, Funabiki, H, Kurumizaka, H. | Deposit date: | 2020-05-01 | Release date: | 2020-09-16 | Last modified: | 2024-03-27 | Method: | ELECTRON MICROSCOPY (3.9 Å) | Cite: | Structural basis for the inhibition of cGAS by nucleosomes. Science, 370, 2020
|
|
4GOO
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4goo by Molmil](/molmil-images/mine/4goo) | |
8G86
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8g86 by Molmil](/molmil-images/mine/8g86) | Human Oct4 bound to nucleosome with human nMatn1 sequence (focused refinement of nucleosome) | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | Authors: | Sinha, K.K, Bilokapic, S, Du, Y, Malik, D, Halic, M. | Deposit date: | 2023-02-17 | Release date: | 2023-03-22 | Last modified: | 2024-06-19 | Method: | ELECTRON MICROSCOPY (2.3 Å) | Cite: | Histone modifications regulate pioneer transcription factor cooperativity. Nature, 619, 2023
|
|
3NH2
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3nh2 by Molmil](/molmil-images/mine/3nh2) | |
8QBM
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8qbm by Molmil](/molmil-images/mine/8qbm) | |
8QBL
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8qbl by Molmil](/molmil-images/mine/8qbl) | |
8QBK
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8qbk by Molmil](/molmil-images/mine/8qbk) | |
4GON
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4gon by Molmil](/molmil-images/mine/4gon) | |
7ET6
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7et6 by Molmil](/molmil-images/mine/7et6) | Crystal structure of Arabidopsis TEM1 B3-DNA complex | Descriptor: | AP2/ERF and B3 domain-containing transcription repressor TEM1, FT-RY14-F, FT-RY14-R | Authors: | Hu, H, Du, J. | Deposit date: | 2021-05-12 | Release date: | 2021-09-15 | Last modified: | 2023-11-29 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | TEM1 combinatorially binds to FLOWERING LOCUS T and recruits a Polycomb factor to repress the floral transition in Arabidopsis. Proc.Natl.Acad.Sci.USA, 118, 2021
|
|
7C9A
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7c9a by Molmil](/molmil-images/mine/7c9a) | Human RAD51 post-synaptic complexes mutant (V273P, D274G) | Descriptor: | CALCIUM ION, DNA (5'-D(P*AP*AP*AP*AP*AP*AP*AP*AP*A)-3'), DNA (5'-D(P*TP*TP*TP*TP*TP*TP*TP*TP*T)-3'), ... | Authors: | Chi, H.Y, Ho, M.C, Tsai, M.D, Luo, S.C, Yeh, H.Y. | Deposit date: | 2020-06-05 | Release date: | 2020-11-18 | Last modified: | 2024-03-27 | Method: | ELECTRON MICROSCOPY (3.43 Å) | Cite: | Identification of fidelity-governing factors in human recombinases DMC1 and RAD51 from cryo-EM structures. Nat Commun, 12, 2021
|
|
1KX4
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kx4 by Molmil](/molmil-images/mine/1kx4) | X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution | Descriptor: | CHLORIDE ION, DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3'), MANGANESE (II) ION, ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
1DJ6
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1dj6 by Molmil](/molmil-images/mine/1dj6) | COMPLEX OF A Z-DNA HEXAMER, D(CG)3, WITH SYNTHETIC POLYAMINE AT ROOM TEMPERATURE | Descriptor: | 5'-D(*CP*GP*CP*GP*CP*G)-3', MAGNESIUM ION, N,N'-BIS(2-AMINOETHYL)-1,2-ETHANEDIAMINE | Authors: | Ohishi, H, Tomita, K.-i, Nakanishi, I, Ohtsuchi, M, Hakoshima, T, Rich, A. | Deposit date: | 1999-12-01 | Release date: | 1999-12-18 | Last modified: | 2024-04-03 | Method: | X-RAY DIFFRACTION (1 Å) | Cite: | The crystal structure of N1-[2-(2-amino-ethylamino)-ethyl]-ethane-1,2-diamine (polyamines) binding to the minor groove of d(CGCGCG)2, hexamer at room temperature FEBS Lett., 523, 2002
|
|
6ZUE
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6zue by Molmil](/molmil-images/mine/6zue) | |
1G2F
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1g2f by Molmil](/molmil-images/mine/1g2f) | STRUCTURE OF A CYS2HIS2 ZINC FINGER/TATA BOX COMPLEX (TATAZF;CLONE #6) | Descriptor: | 5'-D(*GP*AP*CP*GP*CP*TP*AP*TP*AP*AP*AP*AP*GP*GP*AP*G)-3', 5'-D(*TP*CP*CP*TP*TP*TP*TP*AP*TP*AP*GP*CP*GP*TP*CP*C)-3', TATA BOX ZINC FINGER PROTEIN, ... | Authors: | Wolfe, S.A, Grant, R.A, Elrod-Erickson, M, Pabo, C.O. | Deposit date: | 2000-10-18 | Release date: | 2001-09-07 | Last modified: | 2024-04-03 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Beyond the "recognition code": structures of two Cys2His2 zinc finger/TATA box complexes. Structure, 9, 2001
|
|
7JOA
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7joa by Molmil](/molmil-images/mine/7joa) | 2:1 cGAS-nucleosome complex | Descriptor: | Cyclic GMP-AMP synthase, DNA (145-MER), Histone H2A type 1, ... | Authors: | Boyer, J.A, Spangler, C.J, Strauss, J.D, Cesmat, A.P, Liu, P, McGinty, R.K, Zhang, Q. | Deposit date: | 2020-08-06 | Release date: | 2020-09-16 | Last modified: | 2024-03-06 | Method: | ELECTRON MICROSCOPY (3.3 Å) | Cite: | Structural basis of nucleosome-dependent cGAS inhibition. Science, 370, 2020
|
|
6URS
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6urs by Molmil](/molmil-images/mine/6urs) | Sleeping Beauty transposase PAI subdomain mutant - H19Y | Descriptor: | Sleeping Beauty transposase PAI subdomain | Authors: | Nesmelova, I.V, Leighton, G.O, Yan, C, Lustig, J, Corona, R.I, Guo, J.T, Ivics, Z. | Deposit date: | 2019-10-24 | Release date: | 2020-10-28 | Last modified: | 2024-05-15 | Method: | SOLUTION NMR | Cite: | H19Y mutation in the primary DNA-recognition subdomain of the Sleeping Beauty transposase improves structural stability, transposon DNA-binding and transposition To Be Published
|
|
7F25
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7f25 by Molmil](/molmil-images/mine/7f25) | |
8Q56
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8q56 by Molmil](/molmil-images/mine/8q56) | |