1KX5
| X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution | Descriptor: | CHLORIDE ION, DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (1.94 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
1KX4
| X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution | Descriptor: | CHLORIDE ION, DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3'), MANGANESE (II) ION, ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
6NOG
| Poised-state Dot1L bound to the H2B-Ubiquitinated nucleosome | Descriptor: | 601 DNA Strand 1, 601 DNA Strand 2, Histone H2A type 1, ... | Authors: | Worden, E.J, Hoffmann, N.A, Wolberger, C. | Deposit date: | 2019-01-16 | Release date: | 2019-02-20 | Last modified: | 2024-03-20 | Method: | ELECTRON MICROSCOPY (3.9 Å) | Cite: | Mechanism of Cross-talk between H2B Ubiquitination and H3 Methylation by Dot1L. Cell, 176, 2019
|
|
6NJ9
| Active state Dot1L bound to the H2B-Ubiquitinated nucleosome, 2-to-1 complex | Descriptor: | 601 DNA Strand 1, 601 DNA Strand 2, Histone H2A type 1, ... | Authors: | Worden, E.J, Hoffmann, N.A, Wolberger, C. | Deposit date: | 2019-01-02 | Release date: | 2019-02-20 | Last modified: | 2021-06-16 | Method: | ELECTRON MICROSCOPY (2.96 Å) | Cite: | Mechanism of Cross-talk between H2B Ubiquitination and H3 Methylation by Dot1L. Cell, 176, 2019
|
|
6NZO
| Set2 bound to nucleosome | Descriptor: | DNA (149-MER), Histone H2B 1.1, Histone H3, ... | Authors: | Halic, M, Bilokapic, S. | Deposit date: | 2019-02-14 | Release date: | 2019-08-28 | Last modified: | 2019-09-04 | Method: | ELECTRON MICROSCOPY (3.8 Å) | Cite: | Nucleosome and ubiquitin position Set2 to methylate H3K36. Nat Commun, 10, 2019
|
|
6NN6
| Structure of Dot1L-H2BK120ub nucleosome complex | Descriptor: | DNA (145-MER), Histone H2A type 1, Histone H2B 1.1, ... | Authors: | Anderson, C.J, Baird, M.R, Hsu, A, Barbour, E.H, Koyama, Y, Borgnia, M.J, McGinty, R.K. | Deposit date: | 2019-01-14 | Release date: | 2019-02-13 | Last modified: | 2024-03-20 | Method: | ELECTRON MICROSCOPY (3.9 Å) | Cite: | Structural Basis for Recognition of Ubiquitylated Nucleosome by Dot1L Methyltransferase. Cell Rep, 26, 2019
|
|
6NQA
| Active state Dot1L bound to the H2B-Ubiquitinated nucleosome, 1-to-1 complex | Descriptor: | 601 DNA Strand 1, 601 DNA Strand 2, Histone H2A type 1, ... | Authors: | Worden, E.J, Hoffmann, N.A, Wolberger, C. | Deposit date: | 2019-01-19 | Release date: | 2019-02-20 | Last modified: | 2020-01-08 | Method: | ELECTRON MICROSCOPY (3.54 Å) | Cite: | Mechanism of Cross-talk between H2B Ubiquitination and H3 Methylation by Dot1L. Cell, 176, 2019
|
|
6O1D
| |
7U4D
| |
6O22
| Structure of Asf1-H3:H4-Rtt109-Vps75 histone chaperone-lysine acetyltransferase complex with the histone substrate. | Descriptor: | Histone H3.2, Histone H4, Histone acetyltransferase RTT109, ... | Authors: | Danilenko, N, Carlomagno, T, Kirkpatrick, J.P. | Deposit date: | 2019-02-22 | Release date: | 2019-07-31 | Last modified: | 2024-05-01 | Method: | SOLUTION NMR, SOLUTION SCATTERING | Cite: | Histone chaperone exploits intrinsic disorder to switch acetylation specificity. Nat Commun, 10, 2019
|
|
8G6Q
| |
8G6S
| |
8G6G
| |
7U51
| |
7U50
| |
7U52
| |
7U53
| |
8GPN
| Human menin in complex with H3K79Me2 nucleosome | Descriptor: | DNA (177-MER), Histone H2A type 1, Histone H2B 1.1, ... | Authors: | Lin, J, Yu, D, Lam, W.H, Dang, S, Zhai, Y, Li, X.D. | Deposit date: | 2022-08-26 | Release date: | 2023-02-15 | Last modified: | 2023-03-01 | Method: | ELECTRON MICROSCOPY (3.2 Å) | Cite: | Menin "reads" H3K79me2 mark in a nucleosomal context. Science, 379, 2023
|
|
7SCY
| Nuc147 bound to single BRCT | Descriptor: | DNA (147-MER), Histone H2A, Histone H2B type 1-J, ... | Authors: | Muthurajan, U.M, Rudolph, J.R. | Deposit date: | 2021-09-29 | Release date: | 2022-01-12 | Last modified: | 2024-06-05 | Method: | ELECTRON MICROSCOPY (4.1 Å) | Cite: | The BRCT domain of PARP1 binds intact DNA and mediates intrastrand transfer. Mol.Cell, 81, 2021
|
|
7SCZ
| Nuc147 bound to multiple BRCTs | Descriptor: | DNA (147-MER), Histone H2A, Histone H2B type 1-J, ... | Authors: | Muthurajan, U.M, Rudolph, J. | Deposit date: | 2021-09-29 | Release date: | 2022-01-19 | Last modified: | 2024-06-05 | Method: | ELECTRON MICROSCOPY (3.5 Å) | Cite: | The BRCT domain of PARP1 binds intact DNA and mediates intrastrand transfer. Mol.Cell, 81, 2021
|
|
1P34
| Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | Authors: | Muthurajan, U.M, Bao, Y, Forsberg, L.J, Edayathumangalam, R.S, Dyer, P.N, White, C.L, Luger, K. | Deposit date: | 2003-04-17 | Release date: | 2004-02-24 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.7 Å) | Cite: | Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions EMBO J., 23, 2004
|
|
1P3L
| Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | Authors: | Muthurajan, U.M, Bao, Y, Forsberg, L.J, Edayathumangalam, R.S, Dyer, P.N, White, C.L, Luger, K. | Deposit date: | 2003-04-17 | Release date: | 2004-02-24 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions EMBO J., 23, 2004
|
|
1N1J
| Crystal structure of the NF-YB/NF-YC histone pair | Descriptor: | NF-YB, NF-YC | Authors: | Romier, C, Cocchiarella, F, Mantovani, R, Moras, D. | Deposit date: | 2002-10-18 | Release date: | 2003-02-18 | Last modified: | 2024-03-13 | Method: | X-RAY DIFFRACTION (1.67 Å) | Cite: | The NF-YB/NF-YC structure gives insight into DNA binding and transcription regulation by CCAAT factor NF-Y J.Biol.Chem., 278, 2003
|
|
1P3M
| Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | Authors: | Muthurajan, U.M, Bao, Y, Forsberg, L.J, Edayathumangalam, R.S, Dyer, P.N, White, C.L, Luger, K. | Deposit date: | 2003-04-17 | Release date: | 2004-02-24 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.9 Å) | Cite: | Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions EMBO J., 23, 2004
|
|
1P3I
| Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | Authors: | Muthurajan, U.M, Bao, Y, Forsberg, L.J, Edayathumangalam, R.S, Dyer, P.N, White, C.L, Luger, K. | Deposit date: | 2003-04-17 | Release date: | 2004-02-24 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions EMBO J., 23, 2004
|
|