6Y83
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6y83 by Molmil](/molmil-images/mine/6y83) | Capsid structure of Leishmania RNA virus 1 | Descriptor: | Capsid protein | Authors: | Prochazkova, M, Fuzik, T, Grybtchuk, D, Falginella, F, Podesvova, L, Yurchenko, V, Vacha, R, Plevka, P. | Deposit date: | 2020-03-03 | Release date: | 2020-11-11 | Last modified: | 2022-03-30 | Method: | ELECTRON MICROSCOPY (3.65 Å) | Cite: | Capsid Structure of Leishmania RNA Virus 1. J.Virol., 95, 2021
|
|
3MMY
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3mmy by Molmil](/molmil-images/mine/3mmy) | |
3AMT
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3amt by Molmil](/molmil-images/mine/3amt) | Crystal structure of the TiaS-tRNA(Ile2)-ATP complex | Descriptor: | ADENOSINE-5'-TRIPHOSPHATE, Putative uncharacterized protein, RNA (78-MER) | Authors: | Numata, T, Osawa, T. | Deposit date: | 2010-08-23 | Release date: | 2011-10-12 | Last modified: | 2013-06-19 | Method: | X-RAY DIFFRACTION (2.9 Å) | Cite: | Structural basis of tRNA agmatinylation essential for AUA codon decoding Nat.Struct.Mol.Biol., 18, 2011
|
|
6H5S
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6h5s by Molmil](/molmil-images/mine/6h5s) | Cryo-EM map of in vitro assembled Measles virus N into nucleocapsid-like particles (NCLPs) bound to viral genomic 5-prime RNA hexamers. | Descriptor: | Nucleocapsid, RNA (5'-R(*AP*CP*CP*AP*GP*A)-3') | Authors: | Desfosses, A, Milles, S, Ringkjobing Jensen, M, Guseva, S, Colletier, J.P, Maurin, D, Schoehn, G, Gutsche, I, Ruigrok, R, Blackledge, M. | Deposit date: | 2018-07-25 | Release date: | 2019-06-12 | Last modified: | 2024-05-15 | Method: | ELECTRON MICROSCOPY (3.3 Å) | Cite: | Assembly and cryo-EM structures of RNA-specific measles virus nucleocapsids provide mechanistic insight into paramyxoviral replication. Proc.Natl.Acad.Sci.USA, 116, 2019
|
|
6H5Q
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6h5q by Molmil](/molmil-images/mine/6h5q) | Cryo-EM structure of in vitro assembled Measles virus N into nucleocapsid-like particles (NCLPs) bound to polyA RNA hexamers. | Descriptor: | Nucleocapsid, RNA (5'-R(*AP*AP*AP*AP*AP*A)-3') | Authors: | Desfosses, A, Milles, S, Ringkjobing Jensen, M, Guseva, S, Colletier, J, Maurin, D, Schoehn, G, Gutsche, I, Ruigrok, R, Blackledge, M. | Deposit date: | 2018-07-25 | Release date: | 2019-03-13 | Last modified: | 2024-05-15 | Method: | ELECTRON MICROSCOPY (3.3 Å) | Cite: | Assembly and cryo-EM structures of RNA-specific measles virus nucleocapsids provide mechanistic insight into paramyxoviral replication. Proc.Natl.Acad.Sci.USA, 116, 2019
|
|
4Q8E
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4q8e by Molmil](/molmil-images/mine/4q8e) | Human DNA polymerase eta inserting dCMPNPP opposite a phenanthriplatin adducted G | Descriptor: | 2'-deoxy-5'-O-[(R)-hydroxy{[(R)-hydroxy(phosphonooxy)phosphoryl]amino}phosphoryl]cytidine, 5'-D(*AP*GP*TP*GP*TP*GP*AP*G)-3', 5'-D(*CP*AP*TP*GP*CP*TP*CP*AP*CP*AP*CP*T)-3', ... | Authors: | Gregory, M.T, Yang, W. | Deposit date: | 2014-04-26 | Release date: | 2014-07-02 | Last modified: | 2024-02-28 | Method: | X-RAY DIFFRACTION (1.549 Å) | Cite: | Structural and mechanistic studies of polymerase eta bypass of phenanthriplatin DNA damage. Proc.Natl.Acad.Sci.USA, 111, 2014
|
|
2VQZ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2vqz by Molmil](/molmil-images/mine/2vqz) | Structure of the cap-binding domain of influenza virus polymerase subunit PB2 with bound m7GTP | Descriptor: | 7N-METHYL-8-HYDROGUANOSINE-5'-TRIPHOSPHATE, POLYMERASE BASIC PROTEIN 2 | Authors: | Guilligay, D, Tarendeau, F, Resa-Infante, P, Coloma, R, Crepin, T, Sehr, P, Lewis, J, Ruigrok, R.W.H, Ortin, J, Hart, D.J, Cusack, S. | Deposit date: | 2008-03-21 | Release date: | 2008-05-13 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | The Structural Basis for CAP Binding by Influenza Virus Polymerase Subunit Pb2. Nat.Struct.Mol.Biol., 15, 2008
|
|
4Q8F
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4q8f by Molmil](/molmil-images/mine/4q8f) | |
4I9Q
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4i9q by Molmil](/molmil-images/mine/4i9q) | Crystal structure of the ternary complex of the D714A mutant of RB69 DNA polymerase | Descriptor: | 2'-deoxy-5'-O-[(R)-hydroxy{[(R)-hydroxy(phosphonooxy)phosphoryl]amino}phosphoryl]guanosine, CALCIUM ION, DNA (5'-D(*GP*CP*GP*GP*AP*CP*TP*GP*CP*TP*TP*AP*C)-3'), ... | Authors: | Guja, K.E, Jacewicz, A, Trzemecka, A, Plochocka, D, Yakubovskaya, E, Bebenek, A, Garcia-Diaz, M. | Deposit date: | 2012-12-05 | Release date: | 2013-10-09 | Last modified: | 2023-09-20 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | A Remote Palm Domain Residue of RB69 DNA Polymerase Is Critical for Enzyme Activity and Influences the Conformation of the Active Site. Plos One, 8, 2013
|
|
4JRC
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4jrc by Molmil](/molmil-images/mine/4jrc) | Distal Stem I region from G. kaustophilus glyQS T box RNA | Descriptor: | Distal Stem I region of the glyQS T box leader RNA, MAGNESIUM ION | Authors: | Grigg, J.C, Ke, A. | Deposit date: | 2013-03-21 | Release date: | 2013-04-24 | Last modified: | 2024-02-28 | Method: | X-RAY DIFFRACTION (2.673 Å) | Cite: | T box RNA decodes both the information content and geometry of tRNA to affect gene expression. Proc.Natl.Acad.Sci.USA, 110, 2013
|
|
1G71
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1g71 by Molmil](/molmil-images/mine/1g71) | CRYSTAL STRUCTURE OF PYROCOCCUS FURIOSUS DNA PRIMASE | Descriptor: | CHLORIDE ION, DNA PRIMASE, SULFATE ION, ... | Authors: | Augustin, M.A, Huber, R, Kaiser, J.T. | Deposit date: | 2000-11-08 | Release date: | 2001-01-10 | Last modified: | 2024-02-07 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | Crystal structure of a DNA-dependent RNA polymerase (DNA primase). Nat.Struct.Biol., 8, 2001
|
|
2CLX
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2clx by Molmil](/molmil-images/mine/2clx) | 4-Arylazo-3,5-diamino-1H-pyrazole CDK Inhibitors: SAR Study, Crystal Structure in Complex with CDK2, Selectivity, and Cellular Effects | Descriptor: | 4-[(E)-(3,5-DIAMINO-1H-PYRAZOL-4-YL)DIAZENYL]PHENOL, CELL DIVISION PROTEIN KINASE 2 | Authors: | Krystof, V, Cankar, P, Frysova, I, Slouka, J, Kontopidis, G, Dzubak, P, Hajduch, M, Deazevedo, W.F, Paprskarova, M, Orsag, M, Rolcik, J, Latr, A, Fischer, P.M, Strnad, M. | Deposit date: | 2006-05-02 | Release date: | 2006-11-01 | Last modified: | 2023-12-13 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | 4-Arylazo-3,5-Diamino-1H-Pyrazole Cdk Inhibitors: Sar Study, Crystal Structure in Complex with Cdk2, Selectivity, and Cellular Effects J.Med.Chem., 49, 2006
|
|
3AX1
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3ax1 by Molmil](/molmil-images/mine/3ax1) | |
2QE5
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2qe5 by Molmil](/molmil-images/mine/2qe5) | |
1QWA
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1qwa by Molmil](/molmil-images/mine/1qwa) | NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12. | Descriptor: | 18S ribosomal RNA, 5'ETS | Authors: | Finger, L.D, Trantirek, L, Johansson, C, Feigon, J. | Deposit date: | 2003-09-01 | Release date: | 2003-11-25 | Last modified: | 2024-05-01 | Method: | SOLUTION NMR | Cite: | Solution Strucutres of Stem-loop RNAs that Bind to the Two N-terminal RNA Binding Domains of Nucleolin Nucleic Acids Res., 31, 2003
|
|
2LBR
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2lbr by Molmil](/molmil-images/mine/2lbr) | |
6HVO
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6hvo by Molmil](/molmil-images/mine/6hvo) | Crystal structure of human PCNA in complex with three peptides of p12 subunit of human polymerase delta | Descriptor: | DNA polymerase delta subunit 4, Proliferating cell nuclear antigen, SULFATE ION | Authors: | Gonzalez-Magana, A, Romano-Moreno, M, Rojas, A.L, Blanco, F.J, De Biasio, A. | Deposit date: | 2018-10-11 | Release date: | 2019-01-23 | Last modified: | 2019-03-27 | Method: | X-RAY DIFFRACTION (2.1 Å) | Cite: | The p12 subunit of human polymerase delta uses an atypical PIP box for molecular recognition of proliferating cell nuclear antigen (PCNA). J.Biol.Chem., 294, 2019
|
|
2A9X
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2a9x by Molmil](/molmil-images/mine/2a9x) | TAR RNA recognition by a cyclic peptidomimetic of Tat protein | Descriptor: | BIV TAR RNA, BIV-2 cyclic peptide | Authors: | Leeper, T.C, Athanassiou, Z, Dias, R.L, Robinson, J.A, Varani, G. | Deposit date: | 2005-07-12 | Release date: | 2005-11-01 | Last modified: | 2022-03-09 | Method: | SOLUTION NMR | Cite: | TAR RNA recognition by a cyclic peptidomimetic of Tat protein. Biochemistry, 44, 2005
|
|
2QE2
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2qe2 by Molmil](/molmil-images/mine/2qe2) | Structure of HCV NS5B Bound to an Anthranilic Acid Inhibitor | Descriptor: | 2-{[N-(2-ACETYL-5-CHLORO-4-FLUOROPHENYL)GLYCYL]AMINO}BENZOIC ACID, RNA-directed RNA polymerase | Authors: | Chopra, R, Svenson, K, Bard, J. | Deposit date: | 2007-06-22 | Release date: | 2007-10-02 | Last modified: | 2023-08-30 | Method: | X-RAY DIFFRACTION (2.9 Å) | Cite: | Identification of Anthranilic Acid Derivatives as a Novel Class of Allosteric Inhibitors of Hepatitis C NS5B Polymerase J.Med.Chem., 50, 2007
|
|
283D
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 283d by Molmil](/molmil-images/mine/283d) | A CURVED RNA HELIX INCORPORATING AN INTERNAL LOOP WITH G-A AND A-A NON-WATSON-CRICK BASE PAIRING | Descriptor: | MANGANESE (II) ION, RNA (5'-R(*GP*GP*CP*CP*GP*AP*AP*AP*GP*GP*CP*C)-3') | Authors: | Baeyens, K.J, De Bondt, H.L, Pardi, A, Holbrook, S.R. | Deposit date: | 1996-09-03 | Release date: | 1996-09-30 | Last modified: | 2024-04-03 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | A curved RNA helix incorporating an internal loop with G.A and A.A non-Watson-Crick base pairing. Proc.Natl.Acad.Sci.USA, 93, 1996
|
|
1HC8
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1hc8 by Molmil](/molmil-images/mine/1hc8) | CRYSTAL STRUCTURE OF A CONSERVED RIBOSOMAL PROTEIN-RNA COMPLEX | Descriptor: | 58 NUCLEOTIDE RIBOSOMAL 23S RNA DOMAIN, MAGNESIUM ION, OSMIUM ION, ... | Authors: | Conn, G.L, Draper, D.E, Lattman, E.E, Gittis, A.G. | Deposit date: | 2001-04-27 | Release date: | 2002-05-23 | Last modified: | 2024-05-08 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | A Compact RNA Tertiary Structure Contains a Buried Backbone-K+ Complex J.Mol.Biol., 318, 2002
|
|
1JID
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1jid by Molmil](/molmil-images/mine/1jid) | Human SRP19 in complex with helix 6 of Human SRP RNA | Descriptor: | HELIX 6 OF HUMAN SRP RNA, MAGNESIUM ION, SIGNAL RECOGNITION PARTICLE 19 KDA PROTEIN | Authors: | Wild, K, Sinning, I, Cusack, S. | Deposit date: | 2001-07-02 | Release date: | 2001-10-19 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | Crystal structure of an early protein-RNA assembly complex of the signal recognition particle. Science, 294, 2001
|
|
28SP
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 28sp by Molmil](/molmil-images/mine/28sp) | |
2A64
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2a64 by Molmil](/molmil-images/mine/2a64) | Crystal Structure of Bacterial Ribonuclease P RNA | Descriptor: | ribonuclease P RNA | Authors: | Kazantsev, A.V, Krivenko, A.A, Harrington, D.J, Holbrook, S.R, Adams, P.D, Pace, N.R. | Deposit date: | 2005-07-01 | Release date: | 2005-09-20 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (3.3 Å) | Cite: | Crystal structure of a bacterial ribonuclease P RNA. Proc.Natl.Acad.Sci.Usa, 102, 2005
|
|
4CGS
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4cgs by Molmil](/molmil-images/mine/4cgs) | Crystal structure of the N-terminal domain of the PA subunit of Dhori virus polymerase | Descriptor: | GLYCEROL, POLYMERASE SUBUNIT PA | Authors: | Guilligay, D, Kadlec, J, Crepin, T, Lunardi, T, Bouvier, D, Kochs, G, Ruigrok, R.W.H, Cusack, S. | Deposit date: | 2013-11-26 | Release date: | 2014-02-05 | Method: | X-RAY DIFFRACTION (1.3 Å) | Cite: | Comparative Structural and Functional Analysis of Orthomyxovirus Polymerase CAP-Snatching Domains. Plos One, 9, 2014
|
|