1QWA
NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.
Summary for 1QWA
Entry DOI | 10.2210/pdb1qwa/pdb |
Related | 1F7F 1F7Y 1JP0 1QWB |
Descriptor | 18S ribosomal RNA, 5'ETS (1 entity in total) |
Functional Keywords | tetraloop, uncg, uucg, ynmg, bulged nucleotide, hairpin, a-form helix, rna |
Biological source | Mus musculus |
Total number of polymer chains | 1 |
Total formula weight | 6680.01 |
Authors | Finger, L.D.,Trantirek, L.,Johansson, C.,Feigon, J. (deposition date: 2003-09-01, release date: 2003-11-25, Last modification date: 2024-05-01) |
Primary citation | Finger, L.D.,Trantirek, L.,Johansson, C.,Feigon, J. Solution Strucutres of Stem-loop RNAs that Bind to the Two N-terminal RNA Binding Domains of Nucleolin Nucleic Acids Res., 31:6461-6472, 2003 Cited by PubMed: 14602904DOI: 10.1093/nar/gkg866 PDB entries with the same primary citation |
Experimental method | SOLUTION NMR |
Structure validation
Download full validation report![Download](/newweb/media/icons/dl.png)
![Download](/newweb/media/icons/dl.png)