1QWA
NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.
Summary for 1QWA
| Entry DOI | 10.2210/pdb1qwa/pdb |
| Related | 1F7F 1F7Y 1JP0 1QWB |
| Descriptor | 18S ribosomal RNA, 5'ETS (1 entity in total) |
| Functional Keywords | tetraloop, uncg, uucg, ynmg, bulged nucleotide, hairpin, a-form helix, rna |
| Biological source | Mus musculus |
| Total number of polymer chains | 1 |
| Total formula weight | 6680.01 |
| Authors | Finger, L.D.,Trantirek, L.,Johansson, C.,Feigon, J. (deposition date: 2003-09-01, release date: 2003-11-25, Last modification date: 2024-05-01) |
| Primary citation | Finger, L.D.,Trantirek, L.,Johansson, C.,Feigon, J. Solution Strucutres of Stem-loop RNAs that Bind to the Two N-terminal RNA Binding Domains of Nucleolin Nucleic Acids Res., 31:6461-6472, 2003 Cited by PubMed Abstract: Nucleolin, a multi-domain protein involved in ribosome biogenesis, has been shown to bind the consensus sequence (U/G)CCCG(A/G) in the context of a hairpin loop structure (nucleolin recognition element; NRE). Previous studies have shown that the first two RNA-binding domains in nucleolin (RBD12) are responsible for the interaction with the in vitro selected NRE (sNRE). We have previously reported the structures of nucleolin RBD12, sNRE and nucleolin RBD12-sNRE complex. A comparison of free and bound sNRE shows that the NRE loop becomes structured upon binding. From this observation, we hypothesized that the disordered hairpin loop of sNRE facilitates conformational rearrangements when the protein binds. Here, we show that nucleolin RBD12 is also sufficient for sequence- specific binding of two NRE sequences found in pre-rRNA, b1NRE and b2NRE. Structural investigations of the free NREs using NMR spectroscopy show that the b1NRE loop is conformationally heterogeneous, while the b2NRE loop is structured. The b2NRE forms a hairpin capped by a YNMG-like tetraloop. Comparison of the chemical shifts of sNRE and b2NRE in complex with nucleolin RBD12 suggests that the NRE consensus nucleotides adopt a similar conformation. These results show that a disordered NRE consensus sequence is not a prerequisite for nucleolin RBD12 binding. PubMed: 14602904DOI: 10.1093/nar/gkg866 PDB entries with the same primary citation |
| Experimental method | SOLUTION NMR |
Structure validation
Download full validation report






