1QWA
NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.
Entity
| Entity ID | Chain ID | Description | Type | Chain length | Formula weight | Number of molecules | DB Name (Accession) | Biological source | Descriptive keywords |
| 1 | A (A) | 18S ribosomal RNA, 5'ETS | polymer | 21 | 6680.0 | 1 | GenBank (M20154) | Mus musculus |
Sequence modifications
A: 3 - 19 (GenBank: M20154)
| PDB | External Database | Details |
|---|---|---|
| G 1 | - | see remark 999 |
| G 2 | - | see remark 999 |
| C 20 | - | see remark 999 |
| C 21 | - | see remark 999 |
Sequence viewer
Contents of the asymmetric unit
| Polymers | Number of chains | 1 |
| Total formula weight | 6680.0 | |
| All* | Total formula weight | 6680.0 |
