1QWA
NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.
Spectrometer
Experimental method: SOLUTION NMR
| Spectrometer ID | Spectrometer maker | Spectrometer model | Spectrometer type | Spectrometer field strength |
| 1 | Bruker | DMX | 500 | |
| 2 | Bruker | DMX | 600 |
Experiment
| experiment id | conditions id | solution id | Experiment type |
| 1 | 1 | 1 | 2D NOESY |
| 2 | 2 | 2 | 2D NOESY |
| 3 | 2 | 2 | 2D TOCSY |
| 4 | 2 | 2 | DQF-COSY |
| 5 | 2 | 4 | 1H-13C HSQC or HMQC |
| 6 | 1 | 3 | 1H-15N HMQC |
NMR Sample
| conditions id | NMR sample pH | NMR sample pressure | NMR sample temperature |
| 1 | 7 | ambient | 278 |
| 2 | 7 | ambient | 298 |
Conformers
| Conformers Calculated Total Number | 17 |
| Conformers Submitted Total Number | 17 |






