1QWB
NMR structure of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12
Summary for 1QWB
Entry DOI | 10.2210/pdb1qwb/pdb |
Related | 1IE1 1IE2 1QWA |
Descriptor | sNRE26 (1 entity in total) |
Functional Keywords | a-form helix, loop e motif, s-turn, disordered hairpin loop, rna |
Total number of polymer chains | 1 |
Total formula weight | 8366.07 |
Authors | Finger, L.D.,Trantirek, L.,Johansson, C.,Feigon, J. (deposition date: 2003-09-01, release date: 2003-11-25, Last modification date: 2020-09-09) |
Primary citation | Finger, L.D.,Trantirek, L.,Johansson, C.,Feigon, J. Solution Structures of Stem-loop RNAs that Bind the Two N-terminal RNA-binding Domains of Nucleolin Nucleic Acids Res., 31:6461-6472, 2003 Cited by PubMed: 14602904DOI: 10.1093/nar/gkg866 PDB entries with the same primary citation |
Experimental method | SOLUTION NMR |
Structure validation
Download full validation report