Loading
PDBj
MenuPDBj@FacebookPDBj@X(formerly Twitter)PDBj@BlueSkyPDBj@YouTubewwPDB FoundationwwPDBDonate
RCSB PDBPDBeBMRBAdv. SearchSearch help

1QWB

NMR structure of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12

Summary for 1QWB
Entry DOI10.2210/pdb1qwb/pdb
Related1IE1 1IE2 1QWA
DescriptorsNRE26 (1 entity in total)
Functional Keywordsa-form helix, loop e motif, s-turn, disordered hairpin loop, rna
Total number of polymer chains1
Total formula weight8366.07
Authors
Finger, L.D.,Trantirek, L.,Johansson, C.,Feigon, J. (deposition date: 2003-09-01, release date: 2003-11-25, Last modification date: 2024-05-01)
Primary citationFinger, L.D.,Trantirek, L.,Johansson, C.,Feigon, J.
Solution Structures of Stem-loop RNAs that Bind the Two N-terminal RNA-binding Domains of Nucleolin
Nucleic Acids Res., 31:6461-6472, 2003
Cited by
PubMed Abstract: Nucleolin, a multi-domain protein involved in ribosome biogenesis, has been shown to bind the consensus sequence (U/G)CCCG(A/G) in the context of a hairpin loop structure (nucleolin recognition element; NRE). Previous studies have shown that the first two RNA-binding domains in nucleolin (RBD12) are responsible for the interaction with the in vitro selected NRE (sNRE). We have previously reported the structures of nucleolin RBD12, sNRE and nucleolin RBD12-sNRE complex. A comparison of free and bound sNRE shows that the NRE loop becomes structured upon binding. From this observation, we hypothesized that the disordered hairpin loop of sNRE facilitates conformational rearrangements when the protein binds. Here, we show that nucleolin RBD12 is also sufficient for sequence- specific binding of two NRE sequences found in pre-rRNA, b1NRE and b2NRE. Structural investigations of the free NREs using NMR spectroscopy show that the b1NRE loop is conformationally heterogeneous, while the b2NRE loop is structured. The b2NRE forms a hairpin capped by a YNMG-like tetraloop. Comparison of the chemical shifts of sNRE and b2NRE in complex with nucleolin RBD12 suggests that the NRE consensus nucleotides adopt a similar conformation. These results show that a disordered NRE consensus sequence is not a prerequisite for nucleolin RBD12 binding.
PubMed: 14602904
DOI: 10.1093/nar/gkg866
PDB entries with the same primary citation
Experimental method
SOLUTION NMR
Structure validation

255239

PDB entries from 2026-06-17

PDB statisticsPDBj update infoContact PDBjnumon