1QWB
NMR structure of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12
Entity
Entity ID | Chain ID | Description | Type | Chain length | Formula weight | Number of molecules | DB Name (Accession) | Biological source | Descriptive keywords |
1 | A | sNRE26 | polymer | 26 | 8366.1 | 1 |
Sequence viewer
Contents of the asymmetric unit
Polymers | Number of chains | 1 |
Total formula weight | 8366.1 | |
All* | Total formula weight | 8366.1 |