1QWB

NMR structure of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12

Entity

Entity ID	Chain ID	Description	Type	Chain length	Formula weight	Number of molecules	DB Name (Accession)	Biological source	Descriptive keywords
1	A	sNRE26	polymer	26	8366.1	1

Contents of the asymmetric unit

Polymers	Number of chains	1
	Total formula weight	8366.1
All*	Total formula weight	8366.1

*Water molecules are not included.