1QWB
NMR structure of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12
History
Please read more about PDB versioning on our help page.
| Version | Date | Type | |
| 1-0 | 2003-11-25 | Initial release | No files available. |
| 1-1 | 2008-04-29 | Version format compliance | No files available. |
| 1-2 | 2011-07-13 | Version format compliance | No files available. |
| 1-3 | 2020-09-09 | Data collection, Derived calculations, Structure summary | No files available. |
| 1-4 | 2024-05-01 | Data collection, Database references |






