7PZI
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7pzi by Molmil](/molmil-images/mine/7pzi) | |
7PZN
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7pzn by Molmil](/molmil-images/mine/7pzn) | |
4B0G
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4b0g by Molmil](/molmil-images/mine/4b0g) | Complex of Aurora-A bound to an Imidazopyridine-based inhibitor | Descriptor: | 6-bromo-2-(1-methyl-1H-imidazol-5-yl)-7-{4-[(5-methyl-1,2-oxazol-3-yl)methyl]piperazin-1-yl}-1H-imidazo[4,5-b]pyridine, AURORA KINASE A, SULFATE ION | Authors: | Kosmopoulou, M, Bayliss, R. | Deposit date: | 2012-07-02 | Release date: | 2013-03-13 | Last modified: | 2023-12-20 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | Optimization of Imidazo[4,5-B]Pyridine-Based Kinase Inhibitors: Identification of a Dual Flt3/Aurora Kinase Inhibitor as an Orally Bioavailable Preclinical Development Candidate for the Treatment of Acute Myeloid Leukemia. J.Med.Chem., 55, 2012
|
|
6QYS
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6qys by Molmil](/molmil-images/mine/6qys) | Solution NMR of synthetic analogues of nisin and mutacin ring A and ring B - Nisin Ring B | Descriptor: | DBB-PRO-GLY-CYS-LYS | Authors: | Dickman, R, Mitchell, S.A, Figueiredo, A, Hansen, D.F, Tabor, A.B. | Deposit date: | 2019-03-09 | Release date: | 2019-09-11 | Last modified: | 2024-05-01 | Method: | SOLUTION NMR | Cite: | Molecular Recognition of Lipid II by Lantibiotics: Synthesis and Conformational Studies of Analogues of Nisin and Mutacin Rings A and B. J.Org.Chem., 84, 2019
|
|
7PZK
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7pzk by Molmil](/molmil-images/mine/7pzk) | HBc-WT in complex with Triton X-100 | Descriptor: | Capsid protein, FRAGMENT OF TRITON X-100 | Authors: | Makbul, C, Boettcher, B. | Deposit date: | 2021-10-12 | Release date: | 2021-12-08 | Last modified: | 2024-07-17 | Method: | ELECTRON MICROSCOPY (3.1 Å) | Cite: | Binding of a Pocket Factor to Hepatitis B Virus Capsids Changes the Rotamer Conformation of Phenylalanine 97. Viruses, 13, 2021
|
|
7PZ9
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7pz9 by Molmil](/molmil-images/mine/7pz9) | HBc-F97L premature secretion phenotype | Descriptor: | Capsid protein | Authors: | Makbul, C, Boettcher, B. | Deposit date: | 2021-10-11 | Release date: | 2021-12-08 | Last modified: | 2024-07-17 | Method: | ELECTRON MICROSCOPY (2.8 Å) | Cite: | Binding of a Pocket Factor to Hepatitis B Virus Capsids Changes the Rotamer Conformation of Phenylalanine 97. Viruses, 13, 2021
|
|
7PZM
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7pzm by Molmil](/molmil-images/mine/7pzm) | HBc-P5T in complex with X-100 | Descriptor: | Capsid protein, FRAGMENT OF TRITON X-100 | Authors: | Makbul, C, Boettcher, B. | Deposit date: | 2021-10-12 | Release date: | 2021-12-08 | Last modified: | 2024-07-17 | Method: | ELECTRON MICROSCOPY (2.9 Å) | Cite: | Binding of a Pocket Factor to Hepatitis B Virus Capsids Changes the Rotamer Conformation of Phenylalanine 97. Viruses, 13, 2021
|
|
7PZL
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7pzl by Molmil](/molmil-images/mine/7pzl) | HBc-F97L premature secretion phenotype | Descriptor: | Capsid protein, FRAGMENT OF TRITON X-100 | Authors: | Makbul, C, Boettcher, B. | Deposit date: | 2021-10-12 | Release date: | 2021-12-08 | Last modified: | 2024-07-17 | Method: | ELECTRON MICROSCOPY (2.8 Å) | Cite: | Binding of a Pocket Factor to Hepatitis B Virus Capsids Changes the Rotamer Conformation of Phenylalanine 97. Viruses, 13, 2021
|
|
6QYT
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6qyt by Molmil](/molmil-images/mine/6qyt) | Solution NMR of synthetic analogues of nisin and mutacin ring A and ring B - Mutacin I Ring A truncated analogue | Descriptor: | DAL-LEU-SER-LEU-CYS-ALA | Authors: | Dickman, R, Mitchell, S.A, Figueiredo, A, Hansen, D.F, Tabor, A.B. | Deposit date: | 2019-03-09 | Release date: | 2019-09-11 | Last modified: | 2023-06-14 | Method: | SOLUTION NMR | Cite: | Molecular Recognition of Lipid II by Lantibiotics: Synthesis and Conformational Studies of Analogues of Nisin and Mutacin Rings A and B. J.Org.Chem., 84, 2019
|
|
6QYW
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6qyw by Molmil](/molmil-images/mine/6qyw) | Solution NMR of synthetic analogues of nisin and mutacin ring A and ring B - nisin ring A | Descriptor: | ILE-DBU-DAL-ILE-DHA-LEU-CYS-ALA | Authors: | Dickman, R, Mitchell, S.A, Figueiredo, A, Hansen, D.F, Tabor, A.B. | Deposit date: | 2019-03-09 | Release date: | 2019-09-11 | Last modified: | 2019-10-02 | Method: | SOLUTION NMR | Cite: | Molecular Recognition of Lipid II by Lantibiotics: Synthesis and Conformational Studies of Analogues of Nisin and Mutacin Rings A and B. J.Org.Chem., 84, 2019
|
|
6WFS
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6wfs by Molmil](/molmil-images/mine/6wfs) | Cryo-EM Structure of Hepatitis B virus T=4 capsid in complex with the antiviral molecule DBT1 | Descriptor: | 11-oxo-N-[2-(4-sulfamoylphenyl)ethyl]-10,11-dihydrodibenzo[b,f][1,4]thiazepine-8-carboxamide, Capsid protein | Authors: | Schlicksup, C, Laughlin, P, Dunkelbarger, S, Wang, J.C, Zlotnick, A. | Deposit date: | 2020-04-03 | Release date: | 2020-06-03 | Last modified: | 2024-03-06 | Method: | ELECTRON MICROSCOPY (4.6 Å) | Cite: | Local Stabilization of Subunit-Subunit Contacts Causes Global Destabilization of Hepatitis B Virus Capsids. Acs Chem.Biol., 15, 2020
|
|
1R7W
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1r7w by Molmil](/molmil-images/mine/1r7w) | NMR STRUCTURE OF THE R(GGAGGACAUCCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUCCCU BULGE | Descriptor: | 34-MER | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | Deposit date: | 2003-10-22 | Release date: | 2004-05-25 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,). Biochemistry, 43, 2004
|
|
1R7Z
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1r7z by Molmil](/molmil-images/mine/1r7z) | NMR STRUCTURE OF THE R(GGAGGACAUUCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUUCCU BULGE | Descriptor: | 34-MER | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | Deposit date: | 2003-10-22 | Release date: | 2004-05-25 | Last modified: | 2024-05-22 | Method: | SOLUTION NMR | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,). Biochemistry, 43, 2004
|
|
1RW8
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1rw8 by Molmil](/molmil-images/mine/1rw8) | Crystal Structure of TGF-beta receptor I kinase with ATP site inhibitor | Descriptor: | 3-(4-FLUOROPHENYL)-2-(6-METHYLPYRIDIN-2-YL)-5,6-DIHYDRO-4H-PYRROLO[1,2-B]PYRAZOLE, TGF-beta receptor type I | Authors: | Zhang, F, Sawyer, J.S. | Deposit date: | 2003-12-16 | Release date: | 2005-02-01 | Last modified: | 2023-08-23 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Synthesis and activity of new aryl- and heteroaryl-substituted 5,6-dihydro-4H-pyrrolo[1,2-b]pyrazole inhibitors of the transforming growth factor-beta type I receptor kinase domain. Bioorg.Med.Chem.Lett., 14, 2004
|
|
5AAF
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5aaf by Molmil](/molmil-images/mine/5aaf) | Aurora A kinase bound to an imidazopyridine inhibitor (14a) | Descriptor: | 3-((4-(6-chloro-2-(1,3-dimethyl-1H-pyrazol-4-yl)-3H-imidazo[4,5-b]pyridin-7-yl)-1H-pyrazol-1-yl)methyl)-N,N-dimethylbenzamide, AURORA KINASE A | Authors: | McIntyre, P.J, Bayliss, R. | Deposit date: | 2015-07-24 | Release date: | 2015-09-02 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (2.78 Å) | Cite: | 7-(Pyrazol-4-Yl)-3H-Imidazo[4,5-B]Pyridine-Based Derivatives for Kinase Inhibition: Co-Crystallisation Studies with Aurora-A Reveal Distinct Differences in the Orientation of the Pyrazole N1-Substituent. Bioorg.Med.Chem.Lett., 25, 2015
|
|
5AAE
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5aae by Molmil](/molmil-images/mine/5aae) | Aurora A kinase bound to an imidazopyridine inhibitor (14d) | Descriptor: | 3-((4-(6-chloro-2-(1,3-dimethyl-1H-pyrazol-4-yl)-3H-imidazo[4,5-b]pyridin-7-yl)-1H-pyrazol-1-yl)methyl)-5-methylisoxazole, AURORA KINASE A | Authors: | McIntyre, P.J, Bayliss, R. | Deposit date: | 2015-07-24 | Release date: | 2015-09-02 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (3.11 Å) | Cite: | 7-(Pyrazol-4-Yl)-3H-Imidazo[4,5-B]Pyridine-Based Derivatives for Kinase Inhibition: Co-Crystallisation Studies with Aurora-A Reveal Distinct Differences in the Orientation of the Pyrazole N1-Substituent. Bioorg.Med.Chem.Lett., 25, 2015
|
|
4V2O
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4v2o by Molmil](/molmil-images/mine/4v2o) | Structure of saposin B in complex with chloroquine | Descriptor: | N4-(7-CHLORO-QUINOLIN-4-YL)-N1,N1-DIETHYL-PENTANE-1,4-DIAMINE, SAPOSIN-B | Authors: | Zubieta, C, Lai, X, Doyle, R.P. | Deposit date: | 2014-10-13 | Release date: | 2015-12-09 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (2.13 Å) | Cite: | The Lysosomal Protein Saposin B Binds Chloroquine. Chemmedchem, 11, 2016
|
|
6XZN
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6xzn by Molmil](/molmil-images/mine/6xzn) | Arabidopsis UV-B photoreceptor UVR8 mutant G101S W285A | Descriptor: | DI(HYDROXYETHYL)ETHER, GLYCEROL, TRIETHYLENE GLYCOL, ... | Authors: | Lau, K, Hothorn, M. | Deposit date: | 2020-02-04 | Release date: | 2021-01-13 | Last modified: | 2024-01-24 | Method: | X-RAY DIFFRACTION (1.75 Å) | Cite: | A constitutively monomeric UVR8 photoreceptor confers enhanced UV-B photomorphogenesis. Proc.Natl.Acad.Sci.USA, 118, 2021
|
|
8FE5
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8fe5 by Molmil](/molmil-images/mine/8fe5) | Structure of J-PKAc chimera complexed with Aplithianine B | Descriptor: | 6-[(6P)-6-(1-methyl-1H-imidazol-5-yl)-2,3-dihydro-4H-1,4-thiazin-4-yl]-7,9-dihydro-8H-purin-8-one, DnaJ homolog subfamily B member 1,cAMP-dependent protein kinase catalytic subunit alpha, cAMP-dependent protein kinase inhibitor alpha | Authors: | Du, L, Wilson, B.A.P, Li, N, Martinez Fiesco, J.A, Dalilian, M, Wang, D, Smith, E.A, Wamiru, A, Goncharova, E.I, Zhang, P, O'Keefe, B.R. | Deposit date: | 2022-12-05 | Release date: | 2023-10-18 | Last modified: | 2024-05-01 | Method: | X-RAY DIFFRACTION (2.51 Å) | Cite: | Discovery and Synthesis of a Naturally Derived Protein Kinase Inhibitor that Selectively Inhibits Distinct Classes of Serine/Threonine Kinases. J.Nat.Prod., 86, 2023
|
|
7A4B
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7a4b by Molmil](/molmil-images/mine/7a4b) | Crystal structure of human protein kinase CK2alpha (CSNK2A1 gene product) in complex with the ATP-competitive inhibitor 5,6-dibromo-1H-triazolo[4,5-b]pyridine | Descriptor: | 5,6-dibromo-1H-triazolo[4,5-b]pyridine, Casein kinase II subunit alpha, GLYCEROL, ... | Authors: | Niefind, K, Lindenblatt, D, Toelzer, C, Bretner, M, Chojnacki, K, Wielechowska, M, Winska, P. | Deposit date: | 2020-08-19 | Release date: | 2020-12-09 | Last modified: | 2024-01-31 | Method: | X-RAY DIFFRACTION (2.06 Å) | Cite: | Synthesis, biological properties and structural study of new halogenated azolo[4,5-b]pyridines as inhibitors of CK2 kinase. Bioorg.Chem., 106, 2021
|
|
7A49
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7a49 by Molmil](/molmil-images/mine/7a49) | Crystal structure of human protein kinase CK2alpha (CSNK2A1 gene product) in complex with the ATP-competitive inhibitor 6-bromo-5-chloro-1H-triazolo[4,5-b]pyridine | Descriptor: | 6-bromanyl-5-chloranyl-1~{H}-[1,2,3]triazolo[4,5-b]pyridine, Casein kinase II subunit alpha, SULFATE ION | Authors: | Niefind, K, Lindenblatt, D, Toelzer, C, Bretner, M, Chojnacki, K, Wielechowska, M, Winska, P. | Deposit date: | 2020-08-19 | Release date: | 2020-12-09 | Last modified: | 2024-01-31 | Method: | X-RAY DIFFRACTION (2.03 Å) | Cite: | Synthesis, biological properties and structural study of new halogenated azolo[4,5-b]pyridines as inhibitors of CK2 kinase. Bioorg.Chem., 106, 2021
|
|
6XZM
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6xzm by Molmil](/molmil-images/mine/6xzm) | Arabidopsis UV-B photoreceptor UVR8 mutant D96N D107N W285A | Descriptor: | DI(HYDROXYETHYL)ETHER, NITRATE ION, TRIETHYLENE GLYCOL, ... | Authors: | Lau, K, Hothorn, M. | Deposit date: | 2020-02-04 | Release date: | 2021-01-13 | Last modified: | 2024-01-24 | Method: | X-RAY DIFFRACTION (2.10009313 Å) | Cite: | A constitutively monomeric UVR8 photoreceptor confers enhanced UV-B photomorphogenesis. Proc.Natl.Acad.Sci.USA, 118, 2021
|
|
6XZL
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6xzl by Molmil](/molmil-images/mine/6xzl) | Arabidopsis UV-B photoreceptor UVR8 mutant D96N D107N | Descriptor: | GLYCEROL, Ultraviolet-B receptor UVR8 | Authors: | Lau, K, Hothorn, M. | Deposit date: | 2020-02-04 | Release date: | 2021-01-13 | Last modified: | 2024-01-24 | Method: | X-RAY DIFFRACTION (1.39 Å) | Cite: | A constitutively monomeric UVR8 photoreceptor confers enhanced UV-B photomorphogenesis. Proc.Natl.Acad.Sci.USA, 118, 2021
|
|
7A4C
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7a4c by Molmil](/molmil-images/mine/7a4c) | Crystal structure of human protein kinase CK2alpha (CSNK2A1 gene product) in complex with the ATP-competitive inhibitor 5,6,7-tribromo-1H-triazolo[4,5-b]pyridine | Descriptor: | 5,6,7-tris(bromanyl)-1~{H}-[1,2,3]triazolo[4,5-b]pyridine, Casein kinase II subunit alpha, GLYCEROL, ... | Authors: | Niefind, K, Lindenblatt, D, Toelzer, C, Bretner, M, Chojnacki, K, Wielechowska, M, Winska, P. | Deposit date: | 2020-08-19 | Release date: | 2020-12-09 | Last modified: | 2024-01-31 | Method: | X-RAY DIFFRACTION (2.502 Å) | Cite: | Synthesis, biological properties and structural study of new halogenated azolo[4,5-b]pyridines as inhibitors of CK2 kinase. Bioorg.Chem., 106, 2021
|
|
6OAD
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6oad by Molmil](/molmil-images/mine/6oad) | 2.05 Angstrom Resolution Crystal Structure of Aminopeptidase B from Escherichia coli str. K-12 substr. MG1655. | Descriptor: | 1,2-ETHANEDIOL, BICARBONATE ION, CALCIUM ION, ... | Authors: | Minasov, G, Shuvalova, L, Wawrzak, Z, Kiryukhina, O, Grimshaw, S, Kwon, K, Satchell, K.J.F, Center for Structural Genomics of Infectious Diseases (CSGID) | Deposit date: | 2019-03-15 | Release date: | 2019-03-27 | Last modified: | 2023-10-11 | Method: | X-RAY DIFFRACTION (2.05 Å) | Cite: | Comparison of metal-bound and unbound structures of aminopeptidase B proteins from Escherichia coli and Yersinia pestis. Protein Sci., 29, 2020
|
|