1U04
 
 | |
1FCP
 | | FERRIC HYDROXAMATE UPTAKE RECEPTOR (FHUA) FROM E.COLI IN COMPLEX WITH BOUND FERRICHROME-IRON | | Descriptor: | 2-TRIDECANOYLOXY-PENTADECANOIC ACID, 3-OXO-PENTADECANOIC ACID, ACETOACETIC ACID, ... | | Authors: | Hofmann, E, Ferguson, A.D, Diederichs, K, Welte, W. | | Deposit date: | 1998-10-14 | | Release date: | 1999-01-13 | | Last modified: | 2020-07-29 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Siderophore-mediated iron transport: crystal structure of FhuA with bound lipopolysaccharide.
Science, 282, 1998
|
|
1MHS
 | | Model of Neurospora crassa proton ATPase | | Descriptor: | Plasma Membrane ATPase | | Authors: | Kuhlbrandt, W. | | Deposit date: | 2002-08-21 | | Release date: | 2002-09-18 | | Last modified: | 2024-02-14 | | Method: | ELECTRON CRYSTALLOGRAPHY (8 Å) | | Cite: | Structure, mechanism and regulation of the Neurospora plasma membrane H+-ATPase
Science, 297, 2002
|
|
5JA5
 | | Crystal structure of the rice Topless related protein 2 (TPR2) N-terminal topless domain (1-209) L111A and L130A mutant in complex with rice D53 repressor EAR peptide motif | | Descriptor: | Protein TPR1, The rice D53 peptide (a.a. 794-808), ZINC ION | | Authors: | Ke, J, Ma, H, Gu, X, Brunzelle, J.S, Xu, H.E, Melcher, K. | | Deposit date: | 2016-04-12 | | Release date: | 2017-07-05 | | Last modified: | 2023-09-27 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | A D53 repression motif induces oligomerization of TOPLESS corepressors and promotes assembly of a corepressor-nucleosome complex.
Sci Adv, 3, 2017
|
|
5JHP
 | | Crystal structure of the rice Topless related protein 2 (TPR2) N-terminal topless domain (1-209) L179A and I195A mutant in complex with rice D53 repressor EAR peptide motif | | Descriptor: | Protein TPR1, The rice D53 EAR peptide (794-808) | | Authors: | Ke, J, Ma, H, Gu, X, Brunzelle, J.S, Xu, H.E, Melcher, K. | | Deposit date: | 2016-04-21 | | Release date: | 2017-07-05 | | Last modified: | 2023-09-27 | | Method: | X-RAY DIFFRACTION (3.15 Å) | | Cite: | A D53 repression motif induces oligomerization of TOPLESS corepressors and promotes assembly of a corepressor-nucleosome complex.
Sci Adv, 3, 2017
|
|
5J9K
 | | Crystal structure of the rice Topless related protein 2 (TPR2) N-terminal topless domain (1-209) in complex with rice D53 repressor EAR peptide motif | | Descriptor: | Protein TPR1, ZINC ION, rice D53 peptide 794-808 | | Authors: | Ke, J, Ma, H, Gu, X, Brunzelle, J.S, Xu, H.E, Melcher, K. | | Deposit date: | 2016-04-10 | | Release date: | 2017-07-05 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (2.55 Å) | | Cite: | A D53 repression motif induces oligomerization of TOPLESS corepressors and promotes assembly of a corepressor-nucleosome complex.
Sci Adv, 3, 2017
|
|
5JGC
 | | Crystal structure of the rice Topless related protein 2 (TPR2) N-terminal topless domain (1-209) L111A, L130A, L179A and I195A mutant | | Descriptor: | Protein TPR1, ZINC ION | | Authors: | Ke, J, Ma, H, Gu, X, Brunzelle, J.S, Xu, H.E, Melcher, K. | | Deposit date: | 2016-04-20 | | Release date: | 2017-07-05 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (2.08 Å) | | Cite: | A D53 repression motif induces oligomerization of TOPLESS corepressors and promotes assembly of a corepressor-nucleosome complex.
Sci Adv, 3, 2017
|
|
4W5Q
 | |
1I6H
 | | RNA POLYMERASE II ELONGATION COMPLEX | | Descriptor: | 5'-D(P*AP*AP*AP*TP*GP*CP*CP*TP*GP*GP*TP*CP*T)-3', 5'-R(P*GP*AP*CP*CP*AP*GP*GP*CP*A)-3', DNA-DIRECTED RNA POLYMERASE II 13.6KD POLYPEPTIDE, ... | | Authors: | Gnatt, A.L, Cramer, P, Kornberg, R.D. | | Deposit date: | 2001-03-02 | | Release date: | 2001-04-23 | | Last modified: | 2023-08-09 | | Method: | X-RAY DIFFRACTION (3.3 Å) | | Cite: | Structural basis of transcription: an RNA polymerase II elongation complex at 3.3 A resolution.
Science, 292, 2001
|
|
5GRB
 | | Crystal structure of 2C helicase from enterovirus 71 (EV71) bound with ATPgammaS | | Descriptor: | EV71 2C ATPase, PHOSPHOTHIOPHOSPHORIC ACID-ADENYLATE ESTER, ZINC ION | | Authors: | Guan, H.X, Tian, J, Qin, B, Wojdyla, J, Wang, M.T, Cui, S. | | Deposit date: | 2016-08-09 | | Release date: | 2017-05-17 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.803 Å) | | Cite: | Crystal structure of 2C helicase from enterovirus 71
SCI ADV, 3, 2017
|
|
5GQ1
 | | Crystal structure of 2C helicase from enterovirus 71 (EV71) | | Descriptor: | Genome polyprotein, PHOSPHATE ION, ZINC ION | | Authors: | Guan, H.X, Tian, J, Qin, B, Wojdyla, J, Wang, M.T, Cui, S. | | Deposit date: | 2016-08-05 | | Release date: | 2017-05-17 | | Last modified: | 2024-03-20 | | Method: | X-RAY DIFFRACTION (2.493 Å) | | Cite: | Crystal structure of 2C helicase from enterovirus 71
SCI ADV, 3, 2017
|
|
4WZB
 | | Crystal Structure of MgAMPPCP-bound Av2-Av1 complex | | Descriptor: | 3-HYDROXY-3-CARBOXY-ADIPIC ACID, FE (II) ION, FE(8)-S(7) CLUSTER, ... | | Authors: | Tezcan, F.A, Kaiser, J.T, Mustafi, D, Walton, M.Y, Howard, J.B, Rees, D.C. | | Deposit date: | 2014-11-19 | | Release date: | 2015-02-25 | | Last modified: | 2024-02-28 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Nitrogenase complexes: multiple docking sites for a nucleotide switch protein.
Science, 309, 2005
|
|
3MJ7
 | | Crystal structure of the complex of JAML and Coxsackie and Adenovirus receptor, CAR | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, Coxsackievirus and adenovirus receptor homolog, ... | | Authors: | Verdino, P, Wilson, I.A. | | Deposit date: | 2010-04-12 | | Release date: | 2010-09-22 | | Last modified: | 2020-07-29 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | The molecular interaction of CAR and JAML recruits the central cell signal transducer PI3K.
Science, 329, 2010
|
|
3MJ6
 | |
2MUS
 | | HADDOCK calculated model of LIN5001 bound to the HET-s amyloid | | Descriptor: | 3''',4'-bis(carboxymethyl)-2,2':5',2'':5'',2''':5''',2''''-quinquethiophene-5,5''''-dicarboxylic acid, Heterokaryon incompatibility protein s | | Authors: | Hermann, U.S, Schuetz, A.K, Shirani, H, Saban, D, Nuvolone, M, Huang, D.H, Li, B, Ballmer, B, Aslund, A.K.O, Mason, J.J, Rushing, E, Budka, H, Hammarstrom, P, Bockmann, A, Caflisch, A, Meier, B.H, Nilsson, P.K.R, Hornemann, S, Aguzzi, A. | | Deposit date: | 2014-09-16 | | Release date: | 2017-02-01 | | Last modified: | 2024-05-01 | | Method: | SOLUTION NMR | | Cite: | Structure-based drug design identifies polythiophenes as antiprion compounds.
Sci Transl Med, 7, 2015
|
|
2V9U
 | | Rim domain of main porin from Mycobacteria smegmatis | | Descriptor: | MSPA | | Authors: | Grueninger, D, Ziegler, M.O.P, Koetter, J.W.A, Treiber, N, Schulze, M.-S, Schulz, G.E. | | Deposit date: | 2007-08-27 | | Release date: | 2008-01-15 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (2.59 Å) | | Cite: | Designed Protein-Protein Association.
Science, 319, 2008
|
|
2VZ8
 | |
2VZ9
 | |
2UV8
 | | Crystal structure of yeast fatty acid synthase with stalled acyl carrier protein at 3.1 angstrom resolution | | Descriptor: | FATTY ACID SYNTHASE SUBUNIT ALPHA (FAS2), FATTY ACID SYNTHASE SUBUNIT BETA (FAS1), FLAVIN MONONUCLEOTIDE | | Authors: | Leibundgut, M, Jenni, S, Frick, C, Ban, N. | | Deposit date: | 2007-03-09 | | Release date: | 2007-04-17 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (3.1 Å) | | Cite: | Structural Basis for Substrate Delivery by Acyl Carrier Protein in the Yeast Fatty Acid Synthase
Science, 316, 2007
|
|
8QJ3
 | |
8QJ4
 | |
8QPF
 | |
1FG0
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
1FFK
 | | CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTION | | Descriptor: | 23S RRNA, 5S RRNA, CADMIUM ION, ... | | Authors: | Ban, N, Nissen, P, Hansen, J, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-25 | | Release date: | 2000-08-14 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | The complete atomic structure of the large ribosomal subunit at 2.4 A resolution.
Science, 289, 2000
|
|
1FFZ
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | | Descriptor: | 23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU)) | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
