1AOI
 
 | | COMPLEX BETWEEN NUCLEOSOME CORE PARTICLE (H3,H4,H2A,H2B) AND 146 BP LONG DNA FRAGMENT | | Descriptor: | HISTONE H2A, HISTONE H2B, HISTONE H3, ... | | Authors: | Luger, K, Maeder, A.W, Richmond, R.K, Sargent, D.F, Richmond, T.J. | | Deposit date: | 1997-07-03 | | Release date: | 1998-09-30 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Crystal structure of the nucleosome core particle at 2.8 A resolution.
Nature, 389, 1997
|
|
2DGC
 | |
1KX5
 | | X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution | | Descriptor: | CHLORIDE ION, DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), ... | | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | | Deposit date: | 2002-01-31 | | Release date: | 2002-12-25 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (1.94 Å) | | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
|
|
3WEE
 | |
1KX4
 | | X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution | | Descriptor: | CHLORIDE ION, DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3'), MANGANESE (II) ION, ... | | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | | Deposit date: | 2002-01-31 | | Release date: | 2002-12-25 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
|
|
1KX3
 | | X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution | | Descriptor: | DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3'), MANGANESE (II) ION, histone H2A.1, ... | | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | | Deposit date: | 2002-01-31 | | Release date: | 2002-12-25 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
|
|
1YTF
 | | YEAST TFIIA/TBP/DNA COMPLEX | | Descriptor: | DNA (5'-D(*GP*TP*TP*TP*TP*AP*TP*AP*TP*AP*CP*AP*TP*AP*CP*A)-3'), DNA (5'-D(*TP*GP*TP*AP*TP*GP*TP*AP*TP*AP*TP*AP*AP*AP*AP*C)-3'), PROTEIN (TATA BINDING PROTEIN (TBP)), ... | | Authors: | Tan, S, Hunziker, Y, Sargent, D.F, Richmond, T.J. | | Deposit date: | 1996-04-05 | | Release date: | 1996-06-20 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.5 Å) | | Cite: | Crystal structure of a yeast TFIIA/TBP/DNA complex.
Nature, 381, 1996
|
|
1ZBB
 | | Structure of the 4_601_167 Tetranucleosome | | Descriptor: | DNA STRAND 1 (ARBITRARY MODEL SEQUENCE), DNA STRAND 2 (ARBITRARY MODEL SEQUENCE), HISTONE H3, ... | | Authors: | Schalch, T, Duda, S, Sargent, D.F, Richmond, T.J. | | Deposit date: | 2005-04-08 | | Release date: | 2005-07-12 | | Last modified: | 2024-11-13 | | Method: | X-RAY DIFFRACTION (9 Å) | | Cite: | X-ray structure of a tetranucleosome and its implications for the chromatin fibre.
Nature, 436, 2005
|
|
5F99
 | |
2Y9Y
 | | Chromatin Remodeling Factor ISW1a(del_ATPase) | | Descriptor: | IMITATION SWITCH PROTEIN 1 (DEL_ATPASE), ISWI ONE COMPLEX PROTEIN 3 | | Authors: | Yamada, K, Frouws, T.D, Angst, B, Fitzgerald, D.J, DeLuca, C, Schimmele, K, Sargent, D.F, Richmond, T.J. | | Deposit date: | 2011-02-17 | | Release date: | 2011-04-20 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (3.25 Å) | | Cite: | Structure and Mechanism of the Chromatin Remodelling Factor Isw1A.
Nature, 472, 2011
|
|
2Y9Z
 | | Chromatin Remodeling Factor ISW1a(del_ATPase) in DNA complex | | Descriptor: | I-DNA/E-DNA, IMITATION SWITCH PROTEIN 1 (DEL_ATPASE), ISWI ONE COMPLEX PROTEIN 3 | | Authors: | Yamada, K, Frouws, T.D, Angst, B, Fitzgerald, D.J, DeLuca, C, Schimmele, K, Sargent, D.F, Richmond, T.J. | | Deposit date: | 2011-02-17 | | Release date: | 2011-04-20 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (3.601 Å) | | Cite: | Structure and Mechanism of the Chromatin Remodelling Factor Isw1A
Nature, 472, 2011
|
|
1MNM
 | |
5OMX
 | |
5ONG
 | | X-Ray crystal structure of a nucleosome core particle with its DNA site-specifically crosslinked to the histone octamer | | Descriptor: | CHLORIDE ION, DNA (147-MER), Histone H2A, ... | | Authors: | Frouws, T.D, Barth, P.D, Richmond, T.J. | | Deposit date: | 2017-08-03 | | Release date: | 2017-11-22 | | Last modified: | 2024-11-13 | | Method: | X-RAY DIFFRACTION (2.797 Å) | | Cite: | Site-Specific Disulfide Crosslinked Nucleosomes with Enhanced Stability.
J. Mol. Biol., 430, 2018
|
|
5OY7
 | | Structure of the 4_601_157 tetranucleosome (P1 form) | | Descriptor: | CHLORIDE ION, DNA (619-MER), Histone H2A, ... | | Authors: | Ekundayo, B, Richmond, T.J, Schalch, T. | | Deposit date: | 2017-09-07 | | Release date: | 2017-09-20 | | Last modified: | 2024-01-17 | | Method: | X-RAY DIFFRACTION (5.774 Å) | | Cite: | Capturing Structural Heterogeneity in Chromatin Fibers.
J. Mol. Biol., 429, 2017
|
|
5ONW
 | | X-Ray crystal structure of a nucleosome core particle with its DNA site-specifically crosslinked to the histone octamer and the two H2A/H2B dimers crosslinked via H2A N38C | | Descriptor: | CHLORIDE ION, DNA (147-MER), Histone H2A, ... | | Authors: | Frouws, T.D, Barth, P.D, Richmond, T.J. | | Deposit date: | 2017-08-04 | | Release date: | 2017-11-22 | | Last modified: | 2024-11-06 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Site-Specific Disulfide Crosslinked Nucleosomes with Enhanced Stability.
J. Mol. Biol., 430, 2018
|
|
1JFU
 | | CRYSTAL STRUCTURE OF THE SOLUBLE DOMAIN OF TLPA FROM BRADYRHIZOBIUM JAPONICUM | | Descriptor: | THIOL:DISULFIDE INTERCHANGE PROTEIN TLPA | | Authors: | Capitani, G, Rossmann, R, Sargent, D.F, Gruetter, M.G, Richmond, T.J, Hennecke, H. | | Deposit date: | 2001-06-22 | | Release date: | 2001-09-19 | | Last modified: | 2024-10-09 | | Method: | X-RAY DIFFRACTION (1.6 Å) | | Cite: | Structure of the soluble domain of a membrane-anchored thioredoxin-like protein from Bradyrhizobium japonicum reveals unusual properties.
J.Mol.Biol., 311, 2001
|
|
1KSO
 | | CRYSTAL STRUCTURE OF APO S100A3 | | Descriptor: | S100 CALCIUM-BINDING PROTEIN A3 | | Authors: | Mittl, P.R, Fritz, G, Sargent, D.F, Richmond, T.J, Heizmann, C.W, Grutter, M.G. | | Deposit date: | 2002-01-14 | | Release date: | 2002-07-31 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (1.7 Å) | | Cite: | Metal-free MIRAS phasing: structure of apo-S100A3.
Acta Crystallogr.,Sect.D, 58, 2002
|
|
1M41
 | | Crystal structure of Escherichia coli alkanesulfonate monooxygenase SsuD at 2.3 A resolution | | Descriptor: | FMNH2-dependent alkanesulfonate monooxygenase | | Authors: | Eichhorn, E, Davey, C.A, Sargent, D.F, Leisinger, T, Richmond, T.J. | | Deposit date: | 2002-07-02 | | Release date: | 2002-12-11 | | Last modified: | 2024-03-13 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Crystal Structure of Escherichia coli Alkanesulfonate Monooxygenase SsuD
J.mol.biol., 324, 2002
|
|
1SRS
 | | SERUM RESPONSE FACTOR (SRF) CORE COMPLEXED WITH SPECIFIC SRE DNA | | Descriptor: | DNA (5'-D(*CP*CP*(5IU)P*TP*CP*CP*TP*AP*AP*TP*TP*AP*GP*GP*CP*CP*AP*TP*G)-3'), DNA (5'-D(*CP*CP*AP*TP*GP*GP*CP*CP*TP*AP*AP*TP*TP*AP*GP*GP*A P*AP*G)-3'), PROTEIN (SERUM RESPONSE FACTOR (SRF)) | | Authors: | Pellegrini, L, Tan, S, Richmond, T.J. | | Deposit date: | 1995-07-28 | | Release date: | 1995-07-28 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | Structure of serum response factor core bound to DNA.
Nature, 376, 1995
|
|
2NZD
 | | Nucleosome core particle containing 145 bp of DNA | | Descriptor: | DNA (145-MER), Histone H2B, Histone H3, ... | | Authors: | Ong, M.S, Richmond, T.J, Davey, C.A. | | Deposit date: | 2006-11-23 | | Release date: | 2007-04-10 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (2.65 Å) | | Cite: | DNA stretching and extreme kinking in the nucleosome core
J.Mol.Biol., 368, 2007
|
|
1NVP
 | | HUMAN TFIIA/TBP/DNA COMPLEX | | Descriptor: | 5'-D(*CP*CP*TP*TP*TP*TP*AP*TP*AP*GP*CP*CP*CP*CP*CP*CP*C)-3', 5'-D(*GP*GP*GP*GP*GP*GP*GP*CP*TP*AP*TP*AP*AP*AP*AP*GP*G)-3', TATA box binding protein, ... | | Authors: | Bleichenbacher, M, Tan, S, Richmond, T.J. | | Deposit date: | 2003-02-04 | | Release date: | 2003-10-21 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Novel interactions between the components of human and yeast TFIIA/TBP/DNA complexes.
J.Mol.Biol., 332, 2003
|
|
1NH2
 | | Crystal structure of a yeast TFIIA/TBP/DNA complex | | Descriptor: | 5'-D(*GP*TP*TP*TP*TP*AP*TP*AP*TP*AP*CP*AP*TP*AP*CP*A)-3', 5'-D(*TP*GP*TP*AP*(5IU)P*GP*TP*AP*TP*AP*(5IU)P*AP*AP*AP*AP*C)-3', Transcription initiation factor IIA large chain, ... | | Authors: | Bleichenbacher, M, Tan, S, Richmond, T.J. | | Deposit date: | 2002-12-18 | | Release date: | 2003-10-21 | | Last modified: | 2024-05-22 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | Novel interactions between the components of human and yeast TFIIA/TBP/DNA complexes.
J.Mol.Biol., 332, 2003
|
|
1F3U
 | |
1EGW
 | | CRYSTAL STRUCTURE OF MEF2A CORE BOUND TO DNA | | Descriptor: | DNA (5'-D(*AP*AP*AP*GP*CP*TP*AP*TP*TP*AP*TP*TP*AP*GP*CP*TP*T)-3'), DNA (5'-D(*TP*AP*AP*GP*CP*TP*AP*AP*TP*AP*AP*TP*AP*GP*CP*TP*T)-3'), MADS BOX TRANSCRIPTION ENHANCER FACTOR 2, ... | | Authors: | Santelli, E, Richmond, T.J. | | Deposit date: | 2000-02-17 | | Release date: | 2000-03-20 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (1.5 Å) | | Cite: | Crystal structure of MEF2A core bound to DNA at 1.5 A resolution.
J.Mol.Biol., 297, 2000
|
|
