2QQ6
 
 | |
4EPA
 | |
3KZG
 | |
3TBL
 | | Structure of Mono-ubiquitinated PCNA: Implications for DNA Polymerase Switching and Okazaki Fragment Maturation | | Descriptor: | Proliferating cell nuclear antigen, Ubiquitin | | Authors: | Zhang, Z, Lee, M, Lee, E, Zhang, S. | | Deposit date: | 2011-08-07 | | Release date: | 2012-05-23 | | Last modified: | 2024-02-28 | | Method: | X-RAY DIFFRACTION (2.903 Å) | | Cite: | Structure of monoubiquitinated PCNA: Implications for DNA polymerase switching and Okazaki fragment maturation.
Cell Cycle, 11, 2012
|
|
5K04
 | | The NatB Acetyltransferase Complex Bound To CoA and MES | | Descriptor: | 2-(N-MORPHOLINO)-ETHANESULFONIC ACID, COENZYME A, N-terminal acetyltransferase B complex subunit NAT3, ... | | Authors: | Hong, H, Cai, Y, Zhang, S, Han, A. | | Deposit date: | 2016-05-17 | | Release date: | 2017-04-19 | | Last modified: | 2024-03-20 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Molecular Basis of Substrate Specific Acetylation by N-Terminal Acetyltransferase NatB
Structure, 25, 2017
|
|
5K18
 | | The NatB Acetyltransferase Complex Bound To bisubstrate inhibitor | | Descriptor: | Bisubstrate inhibitor, COENZYME A, N-terminal acetyltransferase B complex subunit NAT3, ... | | Authors: | Hong, H, Cai, Y, Zhang, S, Han, A. | | Deposit date: | 2016-05-17 | | Release date: | 2017-04-19 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (2.73 Å) | | Cite: | Molecular Basis of Substrate Specific Acetylation by N-Terminal Acetyltransferase NatB
Structure, 25, 2017
|
|
2QH0
 | |
2QVC
 | | Crystal structure of a periplasmic sugar ABC transporter from Thermotoga maritima | | Descriptor: | Sugar ABC transporter, periplasmic sugar-binding protein, beta-D-glucopyranose | | Authors: | Palani, K, Kumaran, D, Burley, S.K, Swaminathan, S, New York SGX Research Center for Structural Genomics (NYSGXRC) | | Deposit date: | 2007-08-08 | | Release date: | 2007-08-28 | | Last modified: | 2021-02-03 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Structure of a periplasmic glucose-binding protein from Thermotoga maritima.
Acta Crystallogr.,Sect.F, 68, 2012
|
|
2QZJ
 | |
1MGY
 | | Structure of the D85S mutant of bacteriorhodopsin with bromide bound | | Descriptor: | 1-[2,6,10.14-TETRAMETHYL-HEXADECAN-16-YL]-2-[2,10,14-TRIMETHYLHEXADECAN-16-YL]GLYCEROL, BROMIDE ION, Bacteriorhodopsin, ... | | Authors: | Facciotti, M.T, Cheung, V.S, Nguyen, D, Rouhani, S, Glaeser, R.M. | | Deposit date: | 2002-08-16 | | Release date: | 2003-07-07 | | Last modified: | 2021-10-27 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Crystal Structure of the Bromide-Bound D85S Mutant of Bacteriorhodopsin:
Principles of Ion Pumping
Biophys.J., 85, 2003
|
|
5E3M
 | | Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) | | Descriptor: | DNA (27-MER), DNA-binding protein Fis | | Authors: | Stella, S, Hancock, S.P, Cascio, D, Johnson, R.C. | | Deposit date: | 2015-10-03 | | Release date: | 2016-03-09 | | Last modified: | 2024-05-22 | | Method: | X-RAY DIFFRACTION (2.886 Å) | | Cite: | DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.
Plos One, 11, 2016
|
|
8E4Y
 | | Cryo-EM structure of human glycerol-3-phosphate acyltransferase 1 (GPAT1) in complex with 2-oxohexadecyl-CoA | | Descriptor: | (2R)-2-hydroxy-3-(phosphonooxy)propyl hexadecanoate, Glycerol-3-phosphate acyltransferase 1, mitochondrial, ... | | Authors: | Johnson, Z.L, Wasilko, D.J, Ammirati, M, Chang, J.S, Han, S, Wu, H. | | Deposit date: | 2022-08-19 | | Release date: | 2022-12-21 | | Last modified: | 2024-06-12 | | Method: | ELECTRON MICROSCOPY (3.4 Å) | | Cite: | Structural basis of the acyl-transfer mechanism of human GPAT1.
Nat.Struct.Mol.Biol., 30, 2023
|
|
8E50
 | | Cryo-EM structure of human glycerol-3-phosphate acyltransferase 1 (GPAT1) in complex with CoA and palmitoyl-LPA | | Descriptor: | (2R)-2-hydroxy-3-(phosphonooxy)propyl hexadecanoate, COENZYME A, Glycerol-3-phosphate acyltransferase 1, ... | | Authors: | Wasilko, D.J, Johnson, Z.L, Ammirati, M, Chang, J.S, Han, S, Wu, H. | | Deposit date: | 2022-08-19 | | Release date: | 2022-12-21 | | Last modified: | 2024-06-19 | | Method: | ELECTRON MICROSCOPY (3.67 Å) | | Cite: | Structural basis of the acyl-transfer mechanism of human GPAT1.
Nat.Struct.Mol.Biol., 30, 2023
|
|
3T2N
 | | Human hepsin protease in complex with the Fab fragment of an inhibitory antibody | | Descriptor: | Antibody, Fab fragment, Heavy Chain, ... | | Authors: | Koschubs, T, Dengl, S, Duerr, H, Kaluza, K, Georges, G, Hartl, C, Jennewein, S, Lanzendoerfer, M, Auer, J, Stern, A, Huang, K.-S, Kostrewa, D, Ries, S, Hansen, S, Kohnert, U, Cramer, P, Mundigl, O. | | Deposit date: | 2011-07-22 | | Release date: | 2011-12-28 | | Last modified: | 2012-07-25 | | Method: | X-RAY DIFFRACTION (2.55 Å) | | Cite: | Allosteric antibody inhibition of human hepsin protease.
Biochem.J., 442, 2012
|
|
3STP
 | | Crystal structure of a putative galactonate dehydratase | | Descriptor: | Galactonate dehydratase, putative, MAGNESIUM ION | | Authors: | Eswaramoorthy, S, Chamala, S, Evans, B, Foti, R, Gizzi, A, Hillerich, B, Kar, A, LaFleur, J, Seidel, R, Villigas, G, Zencheck, W, Almo, S.C, Swaminathan, S, New York Structural Genomics Research Consortium (NYSGRC) | | Deposit date: | 2011-07-11 | | Release date: | 2011-08-17 | | Last modified: | 2023-09-13 | | Method: | X-RAY DIFFRACTION (1.88 Å) | | Cite: | Crystal structure of a putative galactonate dehydratase
To be Published
|
|
3L4A
 | |
3L47
 | |
3L4L
 | |
4E1S
 | | X-ray crystal structure of the transmembrane beta-domain from intimin from EHEC strain O157:H7 | | Descriptor: | (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, (2S)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, CHLORIDE ION, ... | | Authors: | Fairman, J.W, Dautin, N, Wojtowicz, D, Wei, L, Noinaj, N, Barnard, T.J, Udho, E, Finkelstein, A, Przytycka, T.M, Cherezov, V, Buchanan, S.K. | | Deposit date: | 2012-03-07 | | Release date: | 2012-06-13 | | Last modified: | 2024-02-28 | | Method: | X-RAY DIFFRACTION (1.855 Å) | | Cite: | Crystal Structures of the Outer Membrane Domain of Intimin and Invasin from Enterohemorrhagic E. coli and Enteropathogenic Y. pseudotuberculosis.
Structure, 20, 2012
|
|
4E1T
 | | X-ray crystal structure of the transmembrane beta-domain from invasin from Yersinia pseudotuberculosis | | Descriptor: | (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, (2S)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, Invasin | | Authors: | Fairman, J.W, Dautin, N, Wojtowicz, D, Wei, L, Noinaj, N, Barnard, T.J, Udho, E, Finkelstein, A, Przytycka, T.M, Cherezov, V, Buchanan, S.K. | | Deposit date: | 2012-03-07 | | Release date: | 2012-06-13 | | Last modified: | 2023-09-13 | | Method: | X-RAY DIFFRACTION (2.263 Å) | | Cite: | Crystal Structures of the Outer Membrane Domain of Intimin and Invasin from Enterohemorrhagic E. coli and Enteropathogenic Y. pseudotuberculosis.
Structure, 20, 2012
|
|
2G6T
 | |
3TUC
 | | Crystal structure of SYK kinase domain with 1-benzyl-N-(5-(6,7-dimethoxyquinolin-4-yloxy)pyridin-2-yl)-2-oxo-1,2-dihydropyridine-3-carboxamide | | Descriptor: | 1-benzyl-N-{5-[(6,7-dimethoxyquinolin-4-yl)oxy]pyridin-2-yl}-2-oxo-1,2-dihydropyridine-3-carboxamide, Tyrosine-protein kinase SYK | | Authors: | Lovering, F, McDonald, J, Whitlock, G, Glossop, P, Phillips, C, Sabnis, Y, Ryan, M, Fitz, L, Lee, J, Chang, J.S, Han, S, Kurumbail, R, Thorarenson, A. | | Deposit date: | 2011-09-16 | | Release date: | 2012-08-29 | | Last modified: | 2024-02-28 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Identification of Type-II Inhibitors Using Kinase Structures.
Chem.Biol.Drug Des., 80, 2012
|
|
3T8Q
 | | Crystal structure of mandelate racemase/muconate lactonizing enzyme family protein from Hoeflea phototrophica | | Descriptor: | MAGNESIUM ION, MALONATE ION, Mandelate racemase/muconate lactonizing enzyme family protein | | Authors: | Agarwal, R, Chamala, S, Evans, B, Foti, R, Gizzi, A, Hillerich, B, Kar, A, LaFleur, J, Seidel, R, Villigas, G, Zencheck, W, Almo, S.C, Swaminathan, S, New York Structural Genomics Research Consortium (NYSGRC) | | Deposit date: | 2011-08-01 | | Release date: | 2011-08-17 | | Last modified: | 2023-09-13 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Crystal structure of mandelate racemase/muconate lactonizing enzyme family protein from Hoeflea phototrophica
To be Published
|
|
3T69
 | | Crystal structure of a putative 2-dehydro-3-deoxygalactonokinase protein from Sinorhizobium meliloti | | Descriptor: | Putative 2-dehydro-3-deoxygalactonokinase, SULFATE ION | | Authors: | Agarwal, R, Chamala, S, Evans, B, Foti, R, Gizzi, A, Hillerich, B, Kar, A, LaFleur, J, Seidel, R, Villigas, G, Zencheck, W, Almo, S.C, Swaminathan, S, New York Structural Genomics Research Consortium (NYSGRC) | | Deposit date: | 2011-07-28 | | Release date: | 2011-08-17 | | Last modified: | 2024-02-28 | | Method: | X-RAY DIFFRACTION (2.55 Å) | | Cite: | Crystal structure of a putative 2-dehydro-3-deoxygalactonokinase protein from Sinorhizobium meliloti
To be Published
|
|
3T9P
 | | Crystal structure of a putative mandelate racemase/muconate lactonizing enzyme family protein from Roseovarius | | Descriptor: | FORMIC ACID, GLYCEROL, Mandelate racemase/muconate lactonizing enzyme family protein, ... | | Authors: | Agarwal, R, Chamala, S, Evans, B, Foti, R, Gizzi, A, Hillerich, B, Kar, A, LaFleur, J, Seidel, R, Villigas, G, Zencheck, W, Almo, S.C, Swaminathan, S, New York Structural Genomics Research Consortium (NYSGRC) | | Deposit date: | 2011-08-03 | | Release date: | 2011-08-17 | | Last modified: | 2023-09-13 | | Method: | X-RAY DIFFRACTION (1.97 Å) | | Cite: | Crystal structure of a putative mandelate racemase/muconate lactonizing enzyme family protein from Roseovarius
To be Published
|
|
