8HJN
 
 | |
8HJO
 | | Crystal structure of glycosyltransferase SgUGT94-289-3 in complex with UDP state 2 | | Descriptor: | 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, DI(HYDROXYETHYL)ETHER, URIDINE-5'-DIPHOSPHATE, ... | | Authors: | Li, M, Zhang, S, Cui, S. | | Deposit date: | 2022-11-23 | | Release date: | 2024-05-29 | | Last modified: | 2024-08-14 | | Method: | X-RAY DIFFRACTION (1.64 Å) | | Cite: | Structural insights into the catalytic selectivity of glycosyltransferase SgUGT94-289-3 towards mogrosides.
Nat Commun, 15, 2024
|
|
8HJL
 | | Crystal structure of glycosyltransferase SgUGT94-289-3 in complex with M3E | | Descriptor: | (20S)-2,5,8,11,14,17-HEXAMETHYL-3,6,9,12,15,18-HEXAOXAHENICOSANE-1,20-DIOL, (2R,3S,4S,5R,6R)-2-(hydroxymethyl)-6-[[(3S,8S,9R,10S,11S,13R,14S,17S)-17-[(2S,5R)-5-[(2S,3R,4S,5R,6S)-6-(hydroxymethyl)-3-[(2S,3R,4S,5S,6R)-6-(hydroxymethyl)-3,4,5-tris(oxidanyl)oxan-2-yl]oxy-4,5-bis(oxidanyl)oxan-2-yl]oxy-6-methyl-6-oxidanyl-heptan-2-yl]-4,4,9,13,14-pentamethyl-11-oxidanyl-2,3,7,8,10,11,12,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-3-yl]oxy]oxane-3,4,5-triol, 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, ... | | Authors: | Li, M, Zhang, S, Cui, S. | | Deposit date: | 2022-11-23 | | Release date: | 2024-05-29 | | Last modified: | 2024-08-14 | | Method: | X-RAY DIFFRACTION (1.72 Å) | | Cite: | Structural insights into the catalytic selectivity of glycosyltransferase SgUGT94-289-3 towards mogrosides.
Nat Commun, 15, 2024
|
|
3IQ0
 | |
1XI6
 | | Extragenic suppressor from Pyrococcus furiosus Pfu-1862794-001 | | Descriptor: | extragenic suppressor | | Authors: | Zhao, M, Chang, J.C, Zhou, W, Chen, L, Horanyi, P, Xu, H, Yang, H, Liu, Z.-J, Habel, J.E, Lee, D, Chang, S.-H, Rose, J.P, Wang, B.-C, Southeast Collaboratory for Structural Genomics (SECSG) | | Deposit date: | 2004-09-21 | | Release date: | 2004-11-30 | | Last modified: | 2023-10-25 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Extragenic suppressor from Pyrococcus furiosus Pfu-1862794-001
To be published
|
|
3N3I
 | | Crystal Structure of G48V/C95F tethered HIV-1 Protease/Saquinavir complex | | Descriptor: | (2S)-N-[(2S,3R)-4-[(2S,3S,4aS,8aS)-3-(tert-butylcarbamoyl)-3,4,4a,5,6,7,8,8a-octahydro-1H-isoquinolin-2-yl]-3-hydroxy-1 -phenyl-butan-2-yl]-2-(quinolin-2-ylcarbonylamino)butanediamide, Protease | | Authors: | Prashar, V, Bihani, S.C, Das, A, Rao, D.R, Hosur, M.V. | | Deposit date: | 2010-05-20 | | Release date: | 2010-06-09 | | Last modified: | 2024-03-20 | | Method: | X-RAY DIFFRACTION (2.501 Å) | | Cite: | Insights into the mechanism of drug resistance: X-ray structure analysis of G48V/C95F tethered HIV-1 protease dimer/saquinavir complex
Biochem.Biophys.Res.Commun., 396, 2010
|
|
4ZCF
 | | Structural basis of asymmetric DNA methylation and ATP-triggered long-range diffusion by EcoP15I | | Descriptor: | ADENOSINE MONOPHOSPHATE, CALCIUM ION, DNA 20-mer AATCATAGTCTACTGCTGTA, ... | | Authors: | Gupta, Y.K, Chan, S.H, Xu, S.Y, Aggarwal, A.K. | | Deposit date: | 2015-04-15 | | Release date: | 2015-07-29 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Structural basis of asymmetric DNA methylation and ATP-triggered long-range diffusion by EcoP15I.
Nat Commun, 6, 2015
|
|
1XI8
 | | Molybdenum cofactor biosynthesis protein from Pyrococcus furiosus Pfu-1657500-001 | | Descriptor: | Molybdenum cofactor biosynthesis protein | | Authors: | Zhou, W, Zhao, M, Chang, J.C, Liu, Z.-J, Chen, L, Horanyi, P, Xu, H, Yang, H, Habel, J.E, Lee, D, Chang, S.-H, Rose, J.P, Wang, B.-C, Southeast Collaboratory for Structural Genomics (SECSG) | | Deposit date: | 2004-09-21 | | Release date: | 2004-11-30 | | Last modified: | 2023-10-25 | | Method: | X-RAY DIFFRACTION (2.504 Å) | | Cite: | Molybdenum cofactor biosynthesis protein from Pyrococcus furiosus Pfu-1657500-001
To be published
|
|
6N8B
 | | Crystal structure of transcription regulator AcaB from uropathogenic E. coli | | Descriptor: | CALCIUM ION, transcription regulator AcaB | | Authors: | Luo, Z, Hancock, S.J, Schembri, M.A, Kobe, B. | | Deposit date: | 2018-11-29 | | Release date: | 2020-07-15 | | Last modified: | 2024-03-13 | | Method: | X-RAY DIFFRACTION (2.94 Å) | | Cite: | Comprehensive analysis of IncC plasmid conjugation identifies a crucial role for the transcriptional regulator AcaB.
Nat Microbiol, 5, 2020
|
|
4ZKT
 | |
1CCD
 | | REFINED STRUCTURE OF RAT CLARA CELL 17 KDA PROTEIN AT 3.0 ANGSTROMS RESOLUTION | | Descriptor: | CLARA CELL 17 kD PROTEIN, SULFATE ION | | Authors: | Umland, T.C, Swaminathan, S, Furey, W, Singh, G, Pletcher, J, Sax, M. | | Deposit date: | 1991-09-17 | | Release date: | 1994-01-31 | | Last modified: | 2024-10-09 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | Refined structure of rat Clara cell 17 kDa protein at 3.0 A resolution.
J.Mol.Biol., 224, 1992
|
|
3N76
 | | Crystal structure of 3-dehydroquinate dehydratase from Mycobacterium tuberculosis in complex with compound 5 | | Descriptor: | (1S,3R,4R,5S)-1,3,4-TRIHYDROXY-5-(3-PHENOXYPROPYL)CYCLOHEXANECARBOXYLIC ACID, 3-dehydroquinate dehydratase | | Authors: | Dias, M.V.B, Snee, W.C, Bromfield, K.M, Payne, R, Palaninathan, S.K, Ciulli, A, Howard, N.I, Abell, C, Sacchettini, J.C, Blundell, T.L. | | Deposit date: | 2010-05-26 | | Release date: | 2011-05-11 | | Last modified: | 2023-09-06 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | Structural investigation of inhibitor designs targeting 3-dehydroquinate dehydratase from the shikimate pathway of Mycobacterium tuberculosis.
Biochem.J., 436, 2011
|
|
6G4A
 | | FLN5 (full length) | | Descriptor: | Gelation factor | | Authors: | Waudby, C.A, Wlodarski, T, Karyadi, M.-E, Cassaignau, A.M.E, Chan, S.H.S, Wentink, A.S, Schmidt-Engler, J.M, Camilloni, C, Vendruscolo, M, Cabrita, L.D, Christodoulou, J. | | Deposit date: | 2018-03-27 | | Release date: | 2019-04-10 | | Last modified: | 2024-05-15 | | Method: | SOLUTION NMR | | Cite: | Mapping energy landscapes of a growing filamin domain reveals an intermediate associated with proline isomerization during biosynthesis
To Be Published
|
|
5DA3
 | | Crystal structure of PTK6 Kinase domain with inhibitor | | Descriptor: | (2-chloro-4-{[6-cyclopropyl-3-(1H-pyrazol-4-yl)imidazo[1,2-a]pyrazin-8-yl]amino}phenyl)(morpholin-4-yl)methanone, GLYCEROL, Protein-tyrosine kinase 6 | | Authors: | Thakur, M.K, Birudukota, S, Swaminathan, S, Battula, S.K, Vadivelu, S, Tyagi, R, Gosu, R. | | Deposit date: | 2015-08-19 | | Release date: | 2016-08-24 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (1.7 Å) | | Cite: | Co-crystal structures of PTK6: With Dasatinib at 2.24 angstrom , with novel imidazo[1,2-a]pyrazin-8-amine derivative inhibitor at 1.70 angstrom resolution
Biochem. Biophys. Res. Commun., 482, 2017
|
|
7NQA
 | | Crystal structure of Nucleoporin-98 nanobody MS98-6 complex solved at 2.2A resolution | | Descriptor: | 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, Anti-Nup98 Nanobody MS98-6, Nuclear pore complex protein Nup98-Nup96, ... | | Authors: | Sola-Colom, M, Trakhanov, S, Goerlich, D. | | Deposit date: | 2021-03-01 | | Release date: | 2021-07-21 | | Last modified: | 2024-10-09 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | A checkpoint function for Nup98 in nuclear pore formation suggested by novel inhibitory nanobodies.
Embo J., 2024
|
|
8I2H
 | | Follicle stimulating hormone receptor | | Descriptor: | Follicle-stimulating hormone receptor | | Authors: | Duan, J, Xu, P, Yang, J, Ji, Y, Zhang, H, Mao, C, Luan, X, Jiang, Y, Zhang, Y, Zhang, S, Xu, H.E. | | Deposit date: | 2023-01-14 | | Release date: | 2023-03-22 | | Last modified: | 2024-07-03 | | Method: | ELECTRON MICROSCOPY (6 Å) | | Cite: | Mechanism of hormone and allosteric agonist mediated activation of follicle stimulating hormone receptor.
Nat Commun, 14, 2023
|
|
6BY7
 | | Folding DNA into a lipid-conjugated nano-barrel for controlled reconstitution of membrane proteins | | Descriptor: | DNA (26-MER), DNA (27-MER), DNA (29-MER), ... | | Authors: | Dong, Y, Chen, S, Zhang, S, Sodroski, J, Yang, Z, Liu, D, Mao, Y. | | Deposit date: | 2017-12-20 | | Release date: | 2018-02-28 | | Last modified: | 2024-03-13 | | Method: | ELECTRON MICROSCOPY (7.5 Å) | | Cite: | Folding DNA into a Lipid-Conjugated Nanobarrel for Controlled Reconstitution of Membrane Proteins.
Angew. Chem. Int. Ed. Engl., 57, 2018
|
|
12E8
 | | 2E8 FAB FRAGMENT | | Descriptor: | IGG1-KAPPA 2E8 FAB (HEAVY CHAIN), IGG1-KAPPA 2E8 FAB (LIGHT CHAIN) | | Authors: | Rupp, B, Trakhanov, S. | | Deposit date: | 1998-03-14 | | Release date: | 1998-08-05 | | Last modified: | 2023-08-02 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | Structure of a monoclonal 2E8 Fab antibody fragment specific for the low-density lipoprotein-receptor binding region of apolipoprotein E refined at 1.9 A.
Acta Crystallogr.,Sect.D, null, 1999
|
|
8ILB
 | | The complexes of RbcL, AtRaf1 and AtBSD2 (LFB) | | Descriptor: | Protein BUNDLE SHEATH DEFECTIVE 2, chloroplastic, Ribulose bisphosphate carboxylase large chain, ... | | Authors: | Wang, R, Song, H, Zhang, W, Wang, N, Zhang, S, Shao, R. | | Deposit date: | 2023-03-03 | | Release date: | 2023-11-01 | | Last modified: | 2023-12-20 | | Method: | ELECTRON MICROSCOPY (3 Å) | | Cite: | Structural insights into the functions of Raf1 and Bsd2 in hexadecameric Rubisco assembly.
Mol Plant, 16, 2023
|
|
8IO2
 | | The Rubisco assembly intermidate of Arabidopsis thaliana Rubisco accumulation factor 1 (AtRaf1) and Rubisco large subunit (RbcL) | | Descriptor: | Ribulose bisphosphate carboxylase large chain, Rubisco accumulation factor 1.2, chloroplastic | | Authors: | Wang, R, Song, H, Zhang, W, Wang, N, Zhang, S, Shao, R. | | Deposit date: | 2023-03-10 | | Release date: | 2023-11-01 | | Last modified: | 2023-12-20 | | Method: | ELECTRON MICROSCOPY (3.1 Å) | | Cite: | Structural insights into the functions of Raf1 and Bsd2 in hexadecameric Rubisco assembly.
Mol Plant, 16, 2023
|
|
8IOJ
 | | The Rubisco assembly intermidiate of Rubisco large subunit (RbcL) and Arabidopsis thaliana Rubisco accumulation factor 1 (AtRaf1) | | Descriptor: | Ribulose bisphosphate carboxylase large chain, Rubisco accumulation factor 1.2, chloroplastic | | Authors: | Wang, R, Song, H, Zhang, W, Wang, N, Zhang, S, Shao, R. | | Deposit date: | 2023-03-11 | | Release date: | 2023-11-01 | | Last modified: | 2023-12-20 | | Method: | ELECTRON MICROSCOPY (4.1 Å) | | Cite: | Structural insights into the functions of Raf1 and Bsd2 in hexadecameric Rubisco assembly.
Mol Plant, 16, 2023
|
|
8IOL
 | | The complex of Rubisco large subunit (RbcL) | | Descriptor: | Ribulose bisphosphate carboxylase large chain | | Authors: | Wang, R, Song, H, Zhang, W, Wang, N, Zhang, S, Shao, R. | | Deposit date: | 2023-03-11 | | Release date: | 2023-11-01 | | Last modified: | 2023-12-20 | | Method: | ELECTRON MICROSCOPY (2.9 Å) | | Cite: | Structural insights into the functions of Raf1 and Bsd2 in hexadecameric Rubisco assembly.
Mol Plant, 16, 2023
|
|
1ZD0
 | | Crystal structure of Pfu-542154 conserved hypothetical protein | | Descriptor: | MAGNESIUM ION, METHANOL, UNKNOWN ATOM OR ION, ... | | Authors: | Habel, J.E, Liu, Z.J, Horanyi, P.S, Florence, Q.J.T, Tempel, W, Zhou, W, Chen, L, Lee, D, Nguyen, J, Chang, S.H, Bereton, P, Izumi, M, Jenny Jr, F.E, Poole II, F.L, Shah, C, Sugar, F.J, Adams, M.W.W, Rose, J.P, Wang, B.C, Southeast Collaboratory for Structural Genomics (SECSG) | | Deposit date: | 2005-04-13 | | Release date: | 2005-05-17 | | Last modified: | 2017-10-11 | | Method: | X-RAY DIFFRACTION (1.7 Å) | | Cite: | Crystal structure of Pfu-542154 conserved hypothetical protein
To be Published
|
|
3HP0
 | |
3JUL
 | |
