6E74
 
 | | Structure of Human Transthyretin Leu55Pro Mutant in Complex with Tafamidis | | Descriptor: | 2-(3,5-dichlorophenyl)-1,3-benzoxazole-6-carboxylic acid, Transthyretin | | Authors: | Saelices, L, Chung, K, Sawaya, M.R, Cascio, D, Eisenberg, D. | | Deposit date: | 2018-07-25 | | Release date: | 2019-07-31 | | Last modified: | 2024-03-13 | | Method: | X-RAY DIFFRACTION (1.6 Å) | | Cite: | Structural Variants of Transthyretin
To Be Published
|
|
6E70
 | | Structure of Wild Type Human Transthyretin in Complex with Diflunisal | | Descriptor: | 5-(2,4-DIFLUOROPHENYL)-2-HYDROXY-BENZOIC ACID, CALCIUM ION, Transthyretin | | Authors: | Chung, K, Saelices, L, Sawaya, M.R, Cascio, D, Eisenberg, D. | | Deposit date: | 2018-07-25 | | Release date: | 2019-07-31 | | Last modified: | 2024-03-13 | | Method: | X-RAY DIFFRACTION (1.992 Å) | | Cite: | Structural Variants of Transthyretin
To Be Published
|
|
6E76
 | | Structure of Human Transthyretin Asp38Ala/Thr119Met Mutant | | Descriptor: | ACETATE ION, GLYCEROL, SULFATE ION, ... | | Authors: | Saelices, L, Chung, K, Sawaya, M.R, Cascio, D, Eisenberg, D. | | Deposit date: | 2018-07-25 | | Release date: | 2019-07-31 | | Last modified: | 2019-12-18 | | Method: | X-RAY DIFFRACTION (1.6 Å) | | Cite: | Structural Variants of Transthyretin
To Be Published
|
|
6E73
 | | Structure of Human Transthyretin Val30Met Mutant in Complex with Diflunisal | | Descriptor: | 5-(2,4-DIFLUOROPHENYL)-2-HYDROXY-BENZOIC ACID, ACETATE ION, Transthyretin | | Authors: | Chung, K, Saelices, L, Sawaya, M.R, Cascio, D, Eisenberg, D.S. | | Deposit date: | 2018-07-25 | | Release date: | 2019-07-31 | | Last modified: | 2024-03-13 | | Method: | X-RAY DIFFRACTION (1.797 Å) | | Cite: | Structural Variants of Transthyretin
to be published
|
|
6E71
 | | Structure of Human Transthyretin Val30Met/Thr119Met Mutant | | Descriptor: | DI(HYDROXYETHYL)ETHER, Transthyretin | | Authors: | Saelices, L, Chung, K, Sawaya, M.R, Cascio, D, Eisenberg, D. | | Deposit date: | 2018-07-25 | | Release date: | 2019-07-31 | | Last modified: | 2024-03-13 | | Method: | X-RAY DIFFRACTION (1.5 Å) | | Cite: | Structural Variants of Transthyretin
To Be Published
|
|
6E72
 | | Structure of Human Transthyretin Val30Met Mutant in Complex with Tafamidis | | Descriptor: | 2-(3,5-dichlorophenyl)-1,3-benzoxazole-6-carboxylic acid, Transthyretin | | Authors: | Chung, K, Saelices, L, Sawaya, M.R, Cascio, D, Eisenberg, D. | | Deposit date: | 2018-07-25 | | Release date: | 2019-07-31 | | Last modified: | 2019-12-18 | | Method: | X-RAY DIFFRACTION (1.45 Å) | | Cite: | Structural Variants of Transthyretin
To Be Published
|
|
6E78
 | | Structure of Human Transthyretin Asp38Ala Mutant in Complex with Diflunisal | | Descriptor: | 5-(2,4-DIFLUOROPHENYL)-2-HYDROXY-BENZOIC ACID, Transthyretin | | Authors: | Chung, K, Saelices, L, Sawaya, M.R, Cascio, D, Eisenberg, D. | | Deposit date: | 2018-07-25 | | Release date: | 2019-07-31 | | Last modified: | 2019-12-18 | | Method: | X-RAY DIFFRACTION (1.499 Å) | | Cite: | Structural Variants of Transthyretin
To Be Published
|
|
5DTD
 | |
5E3L
 | |
5DS9
 | |
5E3O
 | |
5E3N
 | |
5E3M
 | | Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) | | Descriptor: | DNA (27-MER), DNA-binding protein Fis | | Authors: | Stella, S, Hancock, S.P, Cascio, D, Johnson, R.C. | | Deposit date: | 2015-10-03 | | Release date: | 2016-03-09 | | Last modified: | 2022-03-23 | | Method: | X-RAY DIFFRACTION (2.886 Å) | | Cite: | DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.
Plos One, 11, 2016
|
|
2NTG
 | | Structure of Spin-labeled T4 Lysozyme Mutant T115R7 | | Descriptor: | BETA-MERCAPTOETHANOL, Lysozyme, S-[(4-bromo-1-oxyl-2,2,5,5-tetramethyl-2,5-dihydro-1H-pyrrol-3-yl)methyl] methanesulfonothioate | | Authors: | Guo, Z, Cascio, D, Hideg, K, Hubbell, W.L. | | Deposit date: | 2006-11-07 | | Release date: | 2007-06-12 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (1.4 Å) | | Cite: | Structural determinants of nitroxide motion in spin-labeled proteins: Tertiary contact and solvent-inaccessible sites in helix G of T4 lysozyme.
Protein Sci., 16, 2007
|
|
5DFM
 | | Structure of Tetrahymena telomerase p19 fused to MBP | | Descriptor: | GLYCEROL, Maltose-binding periplasmic protein,Telomerase-associated protein 19, SULFATE ION, ... | | Authors: | Chan, H, Cascio, D, Sawaya, M.R, Feigon, J. | | Deposit date: | 2015-08-27 | | Release date: | 2015-10-28 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (2.301 Å) | | Cite: | Structure of Tetrahymena telomerase reveals previously unknown subunits, functions, and interactions.
Science, 350, 2015
|
|
2IGC
 | | Structure of Spin labeled T4 Lysozyme Mutant T115R1A | | Descriptor: | Lysozyme, S-[(1-oxyl-2,2,5,5-tetramethyl-2,5-dihydro-1H-pyrrol-3-yl)methyl] methanesulfonothioate | | Authors: | Guo, Z, Cascio, D, Hideg, K, Hubbell, W.L. | | Deposit date: | 2006-09-22 | | Release date: | 2007-06-12 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (1.4 Å) | | Cite: | Structural determinants of nitroxide motion in spin-labeled proteins: Tertiary contact and solvent-inaccessible sites in helix G of T4 lysozyme.
Protein Sci., 16, 2007
|
|
6DGC
 | | Crystal structure of the C-terminal catalytic domain of ISC1926 TnpA, an IS607-like serine recombinase | | Descriptor: | ISC1926 TnpA C-terminal catalytic domain | | Authors: | Hancock, S.P, Kumar, P, Cascio, D, Johnson, R.C. | | Deposit date: | 2018-05-17 | | Release date: | 2018-07-18 | | Last modified: | 2023-10-11 | | Method: | X-RAY DIFFRACTION (2.92 Å) | | Cite: | Multiple serine transposase dimers assemble the transposon-end synaptic complex during IS607-family transposition.
Elife, 7, 2018
|
|
4ZK7
 | | Crystal structure of rescued two-component self-assembling tetrahedral cage T33-31 | | Descriptor: | Chorismate mutase, Divalent-cation tolerance protein CutA | | Authors: | Liu, Y, Cascio, D, Sawaya, M.R, Bale, J, Collazo, M.J, Park, R, King, N, Baker, D, Yeates, T. | | Deposit date: | 2015-04-30 | | Release date: | 2015-07-29 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (3.4 Å) | | Cite: | Structure of a designed tetrahedral protein assembly variant engineered to have improved soluble expression.
Protein Sci., 24, 2015
|
|
4ZNN
 | | MicroED structure of the segment, GVVHGVTTVA, from the A53T familial mutant of Parkinson's disease protein, alpha-synuclein residues 47-56 | | Descriptor: | Alpha-synuclein | | Authors: | Rodriguez, J.A, Ivanova, M, Sawaya, M.R, Cascio, D, Reyes, F, Shi, D, Johnson, L, Guenther, E, Sangwan, S, Hattne, J, Nannenga, B, Brewster, A.S, Messerschmidt, M, Boutet, S, Sauter, N.K, Gonen, T, Eisenberg, D.S. | | Deposit date: | 2015-05-05 | | Release date: | 2015-09-09 | | Last modified: | 2024-03-06 | | Method: | ELECTRON CRYSTALLOGRAPHY (1.41 Å) | | Cite: | Structure of the toxic core of alpha-synuclein from invisible crystals.
Nature, 525, 2015
|
|
6DGB
 | | Crystal structure of the C-terminal catalytic domain of IS1535 TnpA, an IS607-like serine recombinase | | Descriptor: | IS607 family transposase IS1535 | | Authors: | Chen, W.Y, Hancock, S.P, Cascio, D, Johnson, R.C. | | Deposit date: | 2018-05-17 | | Release date: | 2018-07-18 | | Last modified: | 2024-03-13 | | Method: | X-RAY DIFFRACTION (2.52 Å) | | Cite: | Multiple serine transposase dimers assemble the transposon-end synaptic complex during IS607-family transposition.
Elife, 7, 2018
|
|
3DH4
 | | Crystal Structure of Sodium/Sugar symporter with bound Galactose from vibrio parahaemolyticus | | Descriptor: | ERBIUM (III) ION, SODIUM ION, Sodium/glucose cotransporter, ... | | Authors: | Abramson, J, Faham, S, Cascio, D. | | Deposit date: | 2008-06-16 | | Release date: | 2008-08-05 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | The crystal structure of a sodium galactose transporter reveals mechanistic insights into Na+/sugar symport.
Science, 321, 2008
|
|
6DKQ
 | | Crystal structure of the Shr Hemoglobin Interacting Domain 2 | | Descriptor: | Heme-binding protein Shr, SULFATE ION | | Authors: | Macdonald, R, Cascio, D, Collazo, M.J, Clubb, R.T. | | Deposit date: | 2018-05-30 | | Release date: | 2018-10-24 | | Last modified: | 2024-03-13 | | Method: | X-RAY DIFFRACTION (1.5 Å) | | Cite: | The Streptococcus pyogenes Shr protein captures human hemoglobin using two structurally unique binding domains.
J.Biol.Chem., 293, 2018
|
|
1SLH
 | | Mycobacterium tuberculosis dUTPase complexed with magnesium and dUDP | | Descriptor: | 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, DEOXYURIDINE-5'-DIPHOSPHATE, Deoxyuridine 5'-triphosphate nucleotidohydrolase, ... | | Authors: | Sawaya, M.R, Chan, S, Segelke, B, Lekin, T, Krupka, H, Cho, U.S, Kim, M.-Y, So, M, Kim, C.-Y, Naranjo, C.M, Rogers, Y.C, Park, M.S, Waldo, G.S, Pashkov, I, Cascio, D, Yeates, T.O, Perry, J.L, Terwilliger, T.C, Eisenberg, D, TB Structural Genomics Consortium (TBSGC) | | Deposit date: | 2004-03-05 | | Release date: | 2004-03-16 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | Crystal structure of the Mycobacterium tuberculosis dUTPase: insights into the catalytic mechanism.
J.Mol.Biol., 341, 2004
|
|
1SM8
 | | M. tuberculosis dUTPase complexed with chromium and dUTP | | Descriptor: | 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, CHROMIUM ION, DEOXYURIDINE-5'-TRIPHOSPHATE, ... | | Authors: | Sawaya, M.R, Chan, S, Segelke, B, Lekin, T, Krupka, H, Cho, U.S, Kim, M.-Y, So, M, Kim, C.-Y, Naranjo, C.M, Rogers, Y.C, Park, M.S, Waldo, G.S, Pashkov, I, Cascio, D, Yeates, T.O, Perry, J.L, Terwilliger, T.C, Eisenberg, D, TB Structural Genomics Consortium (TBSGC) | | Deposit date: | 2004-03-08 | | Release date: | 2004-03-16 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (2.9 Å) | | Cite: | Crystal structure of the Mycobacterium tuberculosis dUTPase: insights into the catalytic mechanism.
J.Mol.Biol., 341, 2004
|
|
1SQ3
 | | Crystal structures of a novel open pore ferritin from the hyperthermophilic Archaeon Archaeoglobus fulgidus. | | Descriptor: | FE (III) ION, ferritin | | Authors: | Johnson, E, Cascio, D, Michael, S, Schroder, I. | | Deposit date: | 2004-03-17 | | Release date: | 2005-04-12 | | Last modified: | 2023-11-15 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Crystal structures of a tetrahedral open pore ferritin from the hyperthermophilic archaeon Archaeoglobus fulgidus.
Structure, 13, 2005
|
|
