2RLL
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2rll by Molmil](/molmil-images/mine/2rll) | CCR5 Nt(7-15) | Descriptor: | 9-mer from C-C chemokine receptor type 5 | Authors: | Bewley, C.A, Lam, S.N. | Deposit date: | 2007-07-21 | Release date: | 2007-09-25 | Last modified: | 2023-11-15 | Method: | SOLUTION NMR | Cite: | Structures of the CCR5 N terminus and of a tyrosine-sulfated antibody with HIV-1 gp120 and CD4 Science, 317, 2007
|
|
6LVB
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6lvb by Molmil](/molmil-images/mine/6lvb) | Structure of Dimethylformamidase, tetramer | Descriptor: | FE (III) ION, N,N-dimethylformamidase large subunit, N,N-dimethylformamidase small subunit | Authors: | Arya, C.A, Yadav, S, Fine, J, Casanal, A, Chopra, G, Ramanathan, G, Subramanian, R, Vinothkumar, K.R. | Deposit date: | 2020-02-02 | Release date: | 2020-06-03 | Last modified: | 2024-03-27 | Method: | ELECTRON MICROSCOPY (2.8 Å) | Cite: | A 2-Tyr-1-carboxylate Mononuclear Iron Center Forms the Active Site of a Paracoccus Dimethylformamidase. Angew.Chem.Int.Ed.Engl., 59, 2020
|
|
1JCI
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1jci by Molmil](/molmil-images/mine/1jci) | Stabilization of the Engineered Cation-binding Loop in Cytochrome c Peroxidase (CcP) | Descriptor: | Cytochrome C Peroxidase, POTASSIUM ION, PROTOPORPHYRIN IX CONTAINING FE | Authors: | Bhaskar, B, Bonagura, C.A, Li, H, Poulos, T.L. | Deposit date: | 2001-06-09 | Release date: | 2002-03-06 | Last modified: | 2024-04-03 | Method: | X-RAY DIFFRACTION (1.9 Å) | Cite: | Cation-induced stabilization of the engineered cation-binding loop in cytochrome c peroxidase (CcP). Biochemistry, 41, 2002
|
|
3IXX
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3ixx by Molmil](/molmil-images/mine/3ixx) | The pseudo-atomic structure of West Nile immature virus in complex with Fab fragments of the anti-fusion loop antibody E53 | Descriptor: | E53 Fab Fragment (chain H), E53 Fab Fragment (chain L), Envelope protein E, ... | Authors: | Cherrier, M.V, Kaufmann, B, Nybakken, G.E, Lok, S.M, Warren, J.T, Nelson, C.A, Kostyuchenko, V.A, Holdaway, H.A, Chipman, P.R, Kuhn, R.J, Diamond, M.S, Rossmann, M.G, Fremont, D.H. | Deposit date: | 2009-02-26 | Release date: | 2009-10-27 | Last modified: | 2024-02-21 | Method: | ELECTRON MICROSCOPY (15 Å) | Cite: | Structural basis for the preferential recognition of immature flaviviruses by a fusion-loop antibody Embo J., 28, 2009
|
|
3KEV
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3kev by Molmil](/molmil-images/mine/3kev) | X-ray crystal structure of a DCUN1 domain-containing protein from Galdieria sulfuraria | Descriptor: | ACETATE ION, Galieria sulfuraria DCUN1 domain-containing protein, SULFATE ION | Authors: | Burgie, E.S, Bingman, C.A, Phillips Jr, G.N, Center for Eukaryotic Structural Genomics (CESG) | Deposit date: | 2009-10-26 | Release date: | 2009-12-01 | Last modified: | 2017-11-01 | Method: | X-RAY DIFFRACTION (1.3 Å) | Cite: | Structural architecture of Galdieria sulphuraria DCN1L. Proteins, 79, 2011
|
|
3W86
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3w86 by Molmil](/molmil-images/mine/3w86) | Structure of Trypanosoma cruzi dihydroorotate dehydrogenase in complex with SH-1-96 | Descriptor: | 1,2-ETHANEDIOL, 5-{4-[4-(methoxycarbonyl)phenyl]butyl}-2,6-dioxo-1,2,3,6-tetrahydropyrimidine-4-carboxylic acid, CACODYLATE ION, ... | Authors: | Inaoka, D.K, Hashimoto, S, Rocha, J.R, Iida, M, Tabuchi, T, Lee, N, Matsuoka, S, Kuranaga, T, Shiba, T, Balogun, E.O, Sakamoto, K, Suzuki, S, Montanari, C.A, Nara, T, Aoki, T, Inoue, M, Honma, T, Tanaka, A, Harada, S, Kita, K. | Deposit date: | 2013-03-12 | Release date: | 2014-03-12 | Last modified: | 2023-11-08 | Method: | X-RAY DIFFRACTION (1.5 Å) | Cite: | Structure of Trypanosoma cruzi dihydroorotate dehydrogenase in complex with SH-1-96 To be Published
|
|
3KM5
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3km5 by Molmil](/molmil-images/mine/3km5) | Crystal Structure Analysis of the K2 Cleaved Adhesin Domain of Lys-gingipain (Kgp) | Descriptor: | CALCIUM ION, GLYCEROL, Lysine specific cysteine protease, ... | Authors: | Li, N, Collyer, C.A, Hunter, N. | Deposit date: | 2009-11-09 | Release date: | 2010-03-31 | Last modified: | 2024-03-20 | Method: | X-RAY DIFFRACTION (1.4 Å) | Cite: | Structure determination and analysis of a haemolytic gingipain adhesin domain from Porphyromonas gingivalis Mol.Microbiol., 76, 2010
|
|
2KFZ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2kfz by Molmil](/molmil-images/mine/2kfz) | KLENOW FRAGMENT WITH BRIDGING-SULFUR SUBSTRATE AND ZINC ONLY | Descriptor: | 5'-D(*GP*CP*TP*TP*AP*(US1)P*G)-3', KLENOW FRAGMENT OF DNA POLYMERASE I, MAGNESIUM ION, ... | Authors: | Brautigam, C.A, Sun, S, Piccirilli, J.A, Steitz, T.A. | Deposit date: | 1998-07-02 | Release date: | 1998-11-11 | Last modified: | 2024-02-21 | Method: | X-RAY DIFFRACTION (2.03 Å) | Cite: | Structures of normal single-stranded DNA and deoxyribo-3'-S-phosphorothiolates bound to the 3'-5' exonucleolytic active site of DNA polymerase I from Escherichia coli. Biochemistry, 38, 1999
|
|
3KDF
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3kdf by Molmil](/molmil-images/mine/3kdf) | X-ray Crystal Structure of the Human Replication Protein A Complex from Wheat Germ Cell Free Expression | Descriptor: | 1,2-ETHANEDIOL, Replication protein A 14 kDa subunit, Replication protein A 32 kDa subunit | Authors: | Burgie, E.S, Bingman, C.A, Phillips Jr, G.N, Fox, B.G, Makino, S.-I, Center for Eukaryotic Structural Genomics (CESG) | Deposit date: | 2009-10-22 | Release date: | 2009-12-01 | Last modified: | 2021-10-13 | Method: | X-RAY DIFFRACTION (1.975 Å) | Cite: | X-ray Crystal Structure of the Human Replication Protein A Complex from Wheat Germ Cell Free Expression To be Published
|
|
2N62
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2n62 by Molmil](/molmil-images/mine/2n62) | ddFLN5+110 | Descriptor: | gelation factor, secretion monitor chimera | Authors: | Cabrita, L.D, Cassaignau, A.M.E, Launay, H.M.M, Waudby, C.A, Camilloni, C, Robertson, A.L, Wang, X, Wlodarski, T, Wentink, A.S, Vendruscolo, M, Dobson, C.M, Christodoulou, J. | Deposit date: | 2015-08-10 | Release date: | 2016-03-02 | Last modified: | 2024-05-01 | Method: | SOLUTION NMR | Cite: | A structural ensemble of a ribosome-nascent chain complex during cotranslational protein folding. Nat.Struct.Mol.Biol., 23, 2016
|
|
6JXD
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6jxd by Molmil](/molmil-images/mine/6jxd) | |
3K34
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3k34 by Molmil](/molmil-images/mine/3k34) | Human carbonic anhydrase II with a sulfonamide inhibitor | Descriptor: | (4-SULFAMOYL-PHENYL)-THIOCARBAMIC ACID O-(2-THIOPHEN-3-YL-ETHYL) ESTER, 4-(HYDROXYMERCURY)BENZOIC ACID, Carbonic anhydrase 2, ... | Authors: | Behnke, C.A, Le Trong, I, Merritt, E.A, Teller, D.C, Stenkamp, R.E. | Deposit date: | 2009-10-01 | Release date: | 2010-05-12 | Last modified: | 2023-09-06 | Method: | X-RAY DIFFRACTION (0.9 Å) | Cite: | Atomic resolution studies of carbonic anhydrase II. Acta Crystallogr.,Sect.D, 66, 2010
|
|
3K54
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3k54 by Molmil](/molmil-images/mine/3k54) | Structures of human Bruton's tyrosine kinase in active and inactive conformations suggests a mechanism of activation for TEC family kinases. | Descriptor: | N-(2-CHLORO-6-METHYLPHENYL)-2-({6-[4-(2-HYDROXYETHYL)PIPERAZIN-1-YL]-2-METHYLPYRIMIDIN-4-YL}AMINO)-1,3-THIAZOLE-5-CARBOXAMIDE, Tyrosine-protein kinase BTK | Authors: | Marcotte, D.J, Liu, Y.-T, Arduini, R.M, Hession, C.A, Miatkowski, K, Wildes, C.P, Cullen, P.F, Hopkins, B.T, Mertsching, E, Jenkins, T.J, Romanowski, M.J, Baker, D.P, Silvian, L.F. | Deposit date: | 2009-10-06 | Release date: | 2010-01-19 | Last modified: | 2023-09-06 | Method: | X-RAY DIFFRACTION (1.94 Å) | Cite: | Structures of human Bruton's tyrosine kinase in active and inactive conformations suggest a mechanism of activation for TEC family kinases. Protein Sci., 19, 2010
|
|
1KX5
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kx5 by Molmil](/molmil-images/mine/1kx5) | X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution | Descriptor: | CHLORIDE ION, DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (1.94 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
3ZDG
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3zdg by Molmil](/molmil-images/mine/3zdg) | Crystal Structure of Ls-AChBP complexed with carbamoylcholine analogue 3-(dimethylamino)butyl dimethylcarbamate (DMABC) | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, 3-(dimethylamino)butyl dimethylcarbamate, ACETYLCHOLINE BINDING PROTEIN, ... | Authors: | Ussing, C.A, Hansen, C.P, Petersen, J.G, Jensen, A.A, Rohde, L.A.H, Ahring, P.K, Nielsen, E.O, Kastrup, J.S, Gajhede, M, Frolund, B, Balle, T. | Deposit date: | 2012-11-26 | Release date: | 2013-02-20 | Last modified: | 2023-12-20 | Method: | X-RAY DIFFRACTION (2.48 Å) | Cite: | Synthesis, Pharmacology, and Biostructural Characterization of Novel Alpha(4)Beta(2) Nicotinic Acetylcholine Receptor Agonists. J.Med.Chem., 56, 2013
|
|
3ZPK
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3zpk by Molmil](/molmil-images/mine/3zpk) | Atomic-resolution structure of a quadruplet cross-beta amyloid fibril. | Descriptor: | TRANSTHYRETIN | Authors: | Fitzpatrick, A.W.P, Debelouchina, G.T, Bayro, M.J, Clare, D.K, Caporini, M.A, Bajaj, V.S, Jaroniec, C.P, Wang, L, Ladizhansky, V, Muller, S.A, MacPhee, C.E, Waudby, C.A, Mott, H.R, de Simone, A, Knowles, T.P.J, Saibil, H.R, Vendruscolo, M, Orlova, E.V, Griffin, R.G, Dobson, C.M. | Deposit date: | 2013-02-28 | Release date: | 2013-12-04 | Last modified: | 2024-07-10 | Method: | ELECTRON MICROSCOPY, SOLID-STATE NMR | Cite: | Atomic Structure and Hierarchical Assembly of a Cross-Beta Amyloid Fibril. Proc.Natl.Acad.Sci.USA, 110, 2013
|
|
2KFN
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2kfn by Molmil](/molmil-images/mine/2kfn) | KLENOW FRAGMENT WITH BRIDGING-SULFUR SUBSTRATE AND MANGANESE | Descriptor: | 5'-D(*GP*CP*TP*TP*AP*(US1)P*G)-3', KLENOW FRAGMENT OF DNA POLYMERASE I, MAGNESIUM ION, ... | Authors: | Brautigam, C.A, Sun, S, Piccirilli, J.A, Steitz, T.A. | Deposit date: | 1998-07-01 | Release date: | 1998-11-11 | Last modified: | 2024-02-21 | Method: | X-RAY DIFFRACTION (2.03 Å) | Cite: | Structures of normal single-stranded DNA and deoxyribo-3'-S-phosphorothiolates bound to the 3'-5' exonucleolytic active site of DNA polymerase I from Escherichia coli. Biochemistry, 38, 1999
|
|
3ZDH
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3zdh by Molmil](/molmil-images/mine/3zdh) | Crystal structure of Ls-AChBP complexed with carbamoylcholine analogue N,N-dimethyl-4-(1-methyl-1H-imidazol-2-yloxy)butan-2-amine | Descriptor: | (2R)-N,N-dimethyl-4-(1-methylimidazol-2-yl)oxy-butan-2-amine, 2-acetamido-2-deoxy-beta-D-glucopyranose, ACETYLCHOLINE BINDING PROTEIN, ... | Authors: | Ussing, C.A, Hansen, C.P, Petersen, J.G, Jensen, A.A, Rohde, L.A.H, Ahring, P.K, Nielsen, E.O, Kastrup, J.S, Gajhede, M, Frolund, B, Balle, T. | Deposit date: | 2012-11-26 | Release date: | 2013-02-20 | Last modified: | 2023-12-20 | Method: | X-RAY DIFFRACTION (2.195 Å) | Cite: | Synthesis, Pharmacology, and Biostructural Characterization of Novel Alpha(4)Beta(2) Nicotinic Acetylcholine Receptor Agonists. J.Med.Chem., 56, 2013
|
|
4AF0
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4af0 by Molmil](/molmil-images/mine/4af0) | Crystal structure of cryptococcal inosine monophosphate dehydrogenase | Descriptor: | INOSINE-5'-MONOPHOSPHATE DEHYDROGENASE, INOSINIC ACID, MYCOPHENOLIC ACID, ... | Authors: | Valkov, E, Stamp, A, Morrow, C.A, Kobe, B, Fraser, J.A. | Deposit date: | 2012-01-15 | Release date: | 2012-10-24 | Last modified: | 2023-12-20 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | De Novo GTP Biosynthesis is Critical for Virulence of the Fungal Pathogen Cryptococcus Neoformans Plos Pathog., 8, 2012
|
|
3KUY
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3kuy by Molmil](/molmil-images/mine/3kuy) | |
3IXS
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3ixs by Molmil](/molmil-images/mine/3ixs) | Ring1B C-terminal domain/RYBP C-terminal domain Complex | Descriptor: | 1,2-ETHANEDIOL, 2-[N-CYCLOHEXYLAMINO]ETHANE SULFONIC ACID, E3 ubiquitin-protein ligase RING2, ... | Authors: | Wang, R, Taylor, A.B, Kim, C.A. | Deposit date: | 2009-09-04 | Release date: | 2010-08-25 | Last modified: | 2024-02-21 | Method: | X-RAY DIFFRACTION (1.7 Å) | Cite: | Polycomb Group Targeting through Different Binding Partners of RING1B C-Terminal Domain. Structure, 18, 2010
|
|
4AFT
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4aft by Molmil](/molmil-images/mine/4aft) | Aplysia californica AChBP in complex with Varenicline | Descriptor: | SOLUBLE ACETYLCHOLINE RECEPTOR, VARENICLINE | Authors: | Rucktooa, P, Haseler, C.A, vanElke, R, Smit, A.B, Gallagher, T, Sixma, T.K. | Deposit date: | 2012-01-23 | Release date: | 2012-05-02 | Last modified: | 2023-12-20 | Method: | X-RAY DIFFRACTION (3.2 Å) | Cite: | Structural Characterization of Binding Mode of Smoking Cessation Drugs to Nicotinic Acetylcholine Receptors Through Study of Ligand Complexes with Acetylcholine-Binding Protein. J.Biol.Chem., 287, 2012
|
|
6IQ4
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6iq4 by Molmil](/molmil-images/mine/6iq4) | Nucleosome core particle cross-linked with a hetero-binuclear molecule possessing RAPTA and gold(I) 4-(diphenylphosphino)benzoic acid groups. | Descriptor: | 4-diphenylphosphanylbenzoic acid, DNA (145-MER), GOLD ION, ... | Authors: | DeFalco, L, Batchelor, L.K, Adhireksan, Z, Dyson, P.J, Davey, C.A. | Deposit date: | 2018-11-06 | Release date: | 2019-10-30 | Last modified: | 2024-03-27 | Method: | X-RAY DIFFRACTION (2.25 Å) | Cite: | Crosslinking Allosteric Sites on the Nucleosome. Angew.Chem.Int.Ed.Engl., 58, 2019
|
|
3K55
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3k55 by Molmil](/molmil-images/mine/3k55) | Structure of beta hairpin deletion mutant of beta toxin from Staphylococcus aureus | Descriptor: | Beta-hemolysin, CHLORIDE ION, SODIUM ION | Authors: | Kruse, A.C, Huseby, M, Shi, K, Digre, J, Ohlendorf, D.H, Earhart, C.A. | Deposit date: | 2009-10-06 | Release date: | 2011-01-26 | Last modified: | 2024-04-03 | Method: | X-RAY DIFFRACTION (3.35 Å) | Cite: | Structure of a mutant beta toxin from Staphylococcus aureus reveals domain swapping and conformational flexibility Acta Crystallogr.,Sect.F, 67, 2011
|
|
3HVL
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3hvl by Molmil](/molmil-images/mine/3hvl) | Tethered PXR-LBD/SRC-1p complexed with SR-12813 | Descriptor: | Pregnane X receptor, Linker, Steroid receptor coactivator 1, ... | Authors: | Lesburg, C.A, Wang, W, Prosise, W.W, Chen, J, Taremi, S.S, Le, H.V, Madison, V, Cui, X, Thomas, A, Cheng, K.C. | Deposit date: | 2009-06-16 | Release date: | 2009-08-04 | Last modified: | 2024-02-21 | Method: | X-RAY DIFFRACTION (2.1 Å) | Cite: | Construction and characterization of a fully active PXR/SRC-1 tethered protein with increased stability Protein Eng.Des.Sel., 21, 2008
|
|