1TXS
 
 | | STEM-LOOP D OF THE CLOVERLEAF DOMAIN OF ENTEROVIRAL 5'UTR RNA | | Descriptor: | Enteroviral 5'-UTR | | Authors: | Du, Z, Yu, J, Ulyanov, N.B, Andino, R, James, T.L. | | Deposit date: | 2004-07-06 | | Release date: | 2004-10-05 | | Last modified: | 2022-03-02 | | Method: | SOLUTION NMR | | Cite: | Solution Structure of a Consensus Stem-Loop D RNA Domain that Plays Important Roles in Regulating Translation and Replication in Enteroviruses and Rhinoviruses
Biochemistry, 43, 2004
|
|
7VOD
 | | Crystal structure of 5-HT2AR in complex with cariprazine | | Descriptor: | (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, 3-[4-[2-[4-[2,3-bis(chloranyl)phenyl]piperazin-1-yl]ethyl]cyclohexyl]-1,1-dimethyl-urea, 5-hydroxytryptamine receptor 2A,Soluble cytochrome b562, ... | | Authors: | Chen, Z, Fan, L, Wang, H, Yu, J, Lu, D, Qi, J, Nie, F, Luo, Z, Liu, Z, Cheng, J, Wang, S. | | Deposit date: | 2021-10-13 | | Release date: | 2021-12-22 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (3.3 Å) | | Cite: | Structure-based design of a novel third-generation antipsychotic drug lead with potential antidepressant properties.
Nat.Neurosci., 25, 2022
|
|
7VOE
 | | Crystal structure of 5-HT2AR in complex with aripiprazole | | Descriptor: | (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, 5-hydroxytryptamine receptor 2A,Soluble cytochrome b562, 7-[4-[4-[2,3-bis(chloranyl)phenyl]piperazin-1-yl]butoxy]-3,4-dihydro-1H-quinolin-2-one, ... | | Authors: | Chen, Z, Fan, L, Wang, H, Yu, J, Lu, D, Qi, J, Nie, F, Luo, Z, Liu, Z, Cheng, J, Wang, S. | | Deposit date: | 2021-10-13 | | Release date: | 2021-12-22 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (2.9 Å) | | Cite: | Structure-based design of a novel third-generation antipsychotic drug lead with potential antidepressant properties.
Nat.Neurosci., 25, 2022
|
|
2OWL
 | | Crystal structure of E. coli RdgC | | Descriptor: | CALCIUM ION, Recombination-associated protein rdgC | | Authors: | Briggs, G.S, McEwan, P.A, Yu, J, Moore, T, Emsley, J, Lloyd, R.G. | | Deposit date: | 2007-02-16 | | Release date: | 2007-03-20 | | Last modified: | 2011-07-13 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Ring Structure of the Escherichia coli DNA-binding Protein RdgC Associated with Recombination and Replication Fork Repair.
J.Biol.Chem., 282, 2007
|
|
3GX8
 | | Structural and biochemical characterization of yeast monothiol glutaredoxin Grx5 | | Descriptor: | Monothiol glutaredoxin-5, mitochondrial, SULFATE ION | | Authors: | Wang, Y, He, Y.X, Yu, J, Xiong, Y, Chen, Y, Zhou, C.Z. | | Deposit date: | 2009-04-01 | | Release date: | 2010-04-14 | | Last modified: | 2023-11-01 | | Method: | X-RAY DIFFRACTION (1.673 Å) | | Cite: | Structural and biochemical characterization of yeast monothiol glutaredoxin Grx5
To be Published
|
|
6LTH
 | | Structure of human BAF Base module | | Descriptor: | AT-rich interactive domain-containing protein 1A, SWI/SNF complex subunit SMARCC2, SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily B member 1, ... | | Authors: | He, S, Wu, Z, Tian, Y, Yu, Z, Yu, J, Wang, X, Li, J, Liu, B, Xu, Y. | | Deposit date: | 2020-01-22 | | Release date: | 2020-02-12 | | Last modified: | 2021-10-13 | | Method: | ELECTRON MICROSCOPY (3 Å) | | Cite: | Structure of nucleosome-bound human BAF complex.
Science, 367, 2020
|
|
6LTJ
 | | Structure of nucleosome-bound human BAF complex | | Descriptor: | AT-rich interactive domain-containing protein 1A, Actin, cytoplasmic 1, ... | | Authors: | He, S, Wu, Z, Tian, Y, Yu, Z, Yu, J, Wang, X, Li, J, Liu, B, Xu, Y. | | Deposit date: | 2020-01-22 | | Release date: | 2020-02-12 | | Last modified: | 2021-10-13 | | Method: | ELECTRON MICROSCOPY (3.7 Å) | | Cite: | Structure of nucleosome-bound human BAF complex.
Science, 367, 2020
|
|
3B5X
 | | Crystal Structure of MsbA from Vibrio cholerae | | Descriptor: | Lipid A export ATP-binding/permease protein msbA | | Authors: | Ward, A, Reyes, C.L, Yu, J, Roth, C.B, Chang, G. | | Deposit date: | 2007-10-26 | | Release date: | 2007-12-04 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (5.5 Å) | | Cite: | Flexibility in the ABC transporter MsbA: Alternating access with a twist.
Proc.Natl.Acad.Sci.Usa, 104, 2007
|
|
3B5Z
 | | Crystal Structure of MsbA from Salmonella typhimurium with ADP Vanadate | | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, Lipid A export ATP-binding/permease protein msbA, VANADATE ION | | Authors: | Ward, A, Reyes, C.L, Yu, J, Roth, C.B, Chang, G. | | Deposit date: | 2007-10-26 | | Release date: | 2007-12-04 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (4.2 Å) | | Cite: | Flexibility in the ABC transporter MsbA: Alternating access with a twist.
Proc.Natl.Acad.Sci.Usa, 104, 2007
|
|
3B5W
 | | Crystal Structure of Eschericia coli MsbA | | Descriptor: | Lipid A export ATP-binding/permease protein msbA | | Authors: | Ward, A, Reyes, C.L, Yu, J, Roth, C.B, Chang, G. | | Deposit date: | 2007-10-26 | | Release date: | 2007-12-04 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (5.3 Å) | | Cite: | Flexibility in the ABC transporter MsbA: Alternating access with a twist.
Proc.Natl.Acad.Sci.Usa, 104, 2007
|
|
3B60
 | | Crystal Structure of MsbA from Salmonella typhimurium with AMPPNP, higher resolution form | | Descriptor: | Lipid A export ATP-binding/permease protein msbA, PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER | | Authors: | Ward, A, Reyes, C.L, Yu, J, Roth, C.B, Chang, G. | | Deposit date: | 2007-10-26 | | Release date: | 2007-12-04 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (3.7 Å) | | Cite: | Flexibility in the ABC transporter MsbA: Alternating access with a twist.
Proc.Natl.Acad.Sci.Usa, 104, 2007
|
|
3B5Y
 | | Crystal Structure of MsbA from Salmonella typhimurium with AMPPNP | | Descriptor: | Lipid A export ATP-binding/permease protein msbA, PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER | | Authors: | Ward, A, Reyes, C.L, Yu, J, Roth, C.B, Chang, G. | | Deposit date: | 2007-10-26 | | Release date: | 2007-12-04 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (4.5 Å) | | Cite: | Flexibility in the ABC transporter MsbA: Alternating access with a twist.
Proc.Natl.Acad.Sci.Usa, 104, 2007
|
|
3CMI
 | |
6PT2
 | | Crystal structure of the active delta opioid receptor in complex with the peptide agonist KGCHM07 | | Descriptor: | (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, CHOLESTEROL, Delta opioid receptor, ... | | Authors: | Claff, T, Yu, J, Blais, V, Patel, N, Martin, C, Wu, L, Han, G.W, Holleran, B.J, Van der Poorten, O, Hanson, M.A, Sarret, P, Gendron, L, Cherezov, V, Katritch, V, Ballet, S, Liu, Z, Muller, C.E, Stevens, R.C. | | Deposit date: | 2019-07-14 | | Release date: | 2019-12-11 | | Last modified: | 2023-11-15 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Elucidating the active delta-opioid receptor crystal structure with peptide and small-molecule agonists.
Sci Adv, 5, 2019
|
|
5ZUE
 | | GTP-bound, double-stranded, curved FtsZ protofilament structure | | Descriptor: | Cell division protein FtsZ, GUANOSINE-5'-TRIPHOSPHATE | | Authors: | Guan, F, Yu, J, Yu, J, Liu, Y, Li, Y, Feng, X.H, Huang, K.C, Chang, Z, Ye, S. | | Deposit date: | 2018-05-07 | | Release date: | 2018-07-04 | | Last modified: | 2024-03-27 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Lateral interactions between protofilaments of the bacterial tubulin homolog FtsZ are essential for cell division
Elife, 7, 2018
|
|
6PT3
 | | Crystal structure of the active delta opioid receptor in complex with the small molecule agonist DPI-287 | | Descriptor: | 4-[(R)-[(2S,5R)-4-benzyl-2,5-dimethylpiperazin-1-yl](3-hydroxyphenyl)methyl]-N,N-diethylbenzamide, Delta opioid receptor | | Authors: | Claff, T, Yu, J, Blais, V, Patel, N, Martin, C, Wu, L, Han, G.W, Holleran, B.J, Van der Poorten, O, Hanson, M.A, Sarret, P, Gendron, L, Cherezov, V, Katritch, V, Ballet, S, Liu, Z, Muller, C.E, Stevens, R.C. | | Deposit date: | 2019-07-14 | | Release date: | 2019-12-11 | | Last modified: | 2023-10-11 | | Method: | X-RAY DIFFRACTION (3.3 Å) | | Cite: | Elucidating the active delta-opioid receptor crystal structure with peptide and small-molecule agonists.
Sci Adv, 5, 2019
|
|
3D8X
 | | Crystal Structure of Saccharomyces cerevisiae NDPPH Dependent Thioredoxin Reductase 1 | | Descriptor: | FLAVIN-ADENINE DINUCLEOTIDE, NADPH DIHYDRO-NICOTINAMIDE-ADENINE-DINUCLEOTIDE PHOSPHATE, Thioredoxin reductase 1 | | Authors: | Zhang, Z.Y, Bao, R, Yu, J, Chen, Y.X, Zhou, C.-Z. | | Deposit date: | 2008-05-26 | | Release date: | 2008-12-09 | | Last modified: | 2023-11-01 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Crystal structure of Saccharomyces cerevisiae cytoplasmic thioredoxin reductase Trr1 reveals the structural basis for species-specific recognition of thioredoxin
Biochim.Biophys.Acta, 1794, 2009
|
|
1R7W
 | | NMR STRUCTURE OF THE R(GGAGGACAUCCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUCCCU BULGE | | Descriptor: | 34-MER | | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | | Deposit date: | 2003-10-22 | | Release date: | 2004-05-25 | | Last modified: | 2022-03-02 | | Method: | SOLUTION NMR | | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,).
Biochemistry, 43, 2004
|
|
1ROQ
 | |
1R7Z
 | | NMR STRUCTURE OF THE R(GGAGGACAUUCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUUCCU BULGE | | Descriptor: | 34-MER | | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | | Deposit date: | 2003-10-22 | | Release date: | 2004-05-25 | | Last modified: | 2022-03-02 | | Method: | SOLUTION NMR | | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,).
Biochemistry, 43, 2004
|
|
8CU6
 | | Crystal structure of A2AAR-StaR2-S277-bRIL in complex with a novel A2a antagonist, LJ-4517 | | Descriptor: | (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, (2R,3R,4R)-2-[(8P)-6-amino-2-(hex-1-yn-1-yl)-8-(thiophen-2-yl)-9H-purin-9-yl]oxolane-3,4-diol, Adenosine receptor A2a,Soluble cytochrome b562, ... | | Authors: | Shiriaeva, A, Park, D.-J, Kim, G, Lee, Y, Hou, X, Jarhad, D.B, Kim, G, Yu, J, Hyun, Y.E, Kim, W, Gao, Z.-G, Jacobson, K.A, Han, G.W, Stevens, R.C, Jeong, L.S, Choi, S, Cherezov, V. | | Deposit date: | 2022-05-16 | | Release date: | 2022-08-31 | | Last modified: | 2023-10-18 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | GPCR Agonist-to-Antagonist Conversion: Enabling the Design of Nucleoside Functional Switches for the A 2A Adenosine Receptor.
J.Med.Chem., 65, 2022
|
|
8CU7
 | | Crystal structure of A2AAR-StaR2-bRIL in complex with a novel A2a antagonist, LJ-4517 | | Descriptor: | (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, (2R,3R,4R)-2-[(8P)-6-amino-2-(hex-1-yn-1-yl)-8-(thiophen-2-yl)-9H-purin-9-yl]oxolane-3,4-diol, Adenosine receptor A2a,Soluble cytochrome b562, ... | | Authors: | Shiriaeva, A, Park, D.-J, Kim, G, Lee, Y, Hou, X, Jarhad, D.B, Kim, G, Yu, J, Hyun, Y.E, Kim, W, Gao, Z.-G, Jacobson, K.A, Han, G.W, Stevens, R.C, Jeong, L.S, Choi, S, Cherezov, V. | | Deposit date: | 2022-05-16 | | Release date: | 2022-08-31 | | Last modified: | 2023-10-18 | | Method: | X-RAY DIFFRACTION (2.05 Å) | | Cite: | GPCR Agonist-to-Antagonist Conversion: Enabling the Design of Nucleoside Functional Switches for the A 2A Adenosine Receptor.
J.Med.Chem., 65, 2022
|
|
3L9Y
 | | Crystal structures of holo and Cu-deficient Cu/ZnSOD from the silkworm Bombyx mori and the implications in Amyotrophic lateral sclerosis | | Descriptor: | COPPER (II) ION, Superoxide dismutase [Cu-Zn], ZINC ION | | Authors: | Zhang, N.-N, He, Y.-X, Li, W.-F, Zhao, F, Yan, L.-F, Zhang, G.-Z, Teng, Y.-B, Yu, J, Chen, Y, Zhou, C.-Z. | | Deposit date: | 2010-01-06 | | Release date: | 2010-03-23 | | Last modified: | 2023-11-01 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Crystal structures of holo and Cu-deficient Cu/Zn-SOD from the silkworm Bombyx mori and the implications in amyotrophic lateral sclerosis.
Proteins, 78, 2010
|
|
3L9E
 | | Crystal structures of holo and Cu-deficient Cu/ZnSOD from the silkworm Bombyx mori and the implications in Amyotrophic lateral sclerosis | | Descriptor: | Superoxide dismutase [Cu-Zn], ZINC ION | | Authors: | Zhang, N.-N, He, Y.-X, Li, W.-F, Zhao, F, Yan, L.-F, Zhang, G.-Z, Teng, Y.-B, Yu, J, Chen, Y, Zhou, C.-Z. | | Deposit date: | 2010-01-05 | | Release date: | 2010-03-31 | | Last modified: | 2023-11-01 | | Method: | X-RAY DIFFRACTION (2.05 Å) | | Cite: | Crystal structures of holo and Cu-deficient Cu/Zn-SOD from the silkworm Bombyx mori and the implications in amyotrophic lateral sclerosis
Proteins, 78, 2010
|
|
6DW0
 | | Cryo-EM structure of the benzodiazepine-sensitive alpha1beta1gamma2S tri-heteromeric GABAA receptor in complex with GABA (Whole map) | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, GAMMA-AMINO-BUTANOIC ACID, Gamma-aminobutyric acid receptor subunit alpha-1,Gamma-aminobutyric acid receptor subunit alpha-1, ... | | Authors: | Phulera, S, Zhu, H, Yu, J, Yoshioka, C, Gouaux, E. | | Deposit date: | 2018-06-26 | | Release date: | 2018-08-08 | | Last modified: | 2023-11-15 | | Method: | ELECTRON MICROSCOPY (3.8 Å) | | Cite: | Cryo-EM structure of the benzodiazepine-sensitive alpha 1 beta 1 gamma 2S tri-heteromeric GABAAreceptor in complex with GABA.
Elife, 7, 2018
|
|
