5KLV
 
 | | Structure of bos taurus cytochrome bc1 with fenamidone inhibited | | Descriptor: | (2R)-3-{[(S)-(2-aminoethoxy)(hydroxy)phosphoryl]oxy}-2-(tetradecanoyloxy)propyl octadecanoate, (5S)-5-methyl-2-(methylsulfanyl)-5-phenyl-3-(phenylamino)-3,5-dihydro-4H-imidazol-4-one, 1,2-DIHEXANOYL-SN-GLYCERO-3-PHOSPHOETHANOLAMINE, ... | | Authors: | Xia, D, Esser, L, Zhou, F, Zhou, Y, Xiao, Y, Tang, W.K, Yu, C.A, Qin, Z. | | Deposit date: | 2016-06-25 | | Release date: | 2016-10-12 | | Last modified: | 2023-09-27 | | Method: | X-RAY DIFFRACTION (2.652 Å) | | Cite: | Hydrogen Bonding to the Substrate Is Not Required for Rieske Iron-Sulfur Protein Docking to the Quinol Oxidation Site of Complex III.
J.Biol.Chem., 291, 2016
|
|
5KVG
 | | Zika specific antibody, ZV-67, bound to ZIKA envelope DIII | | Descriptor: | CHLORIDE ION, ZIKA Envelope DIII, ZV-67 Antibody Fab Heavy Chain, ... | | Authors: | Zhao, H, Nelson, C.A, Fremont, D.H, Center for Structural Genomics of Infectious Diseases (CSGID) | | Deposit date: | 2016-07-14 | | Release date: | 2016-08-03 | | Last modified: | 2016-08-24 | | Method: | X-RAY DIFFRACTION (1.4 Å) | | Cite: | Structural Basis of Zika Virus-Specific Antibody Protection.
Cell, 166, 2016
|
|
5KOS
 | | Discovery of TAK-272: A Novel, Potent and Orally Active Renin In-hibitor | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-~{tert}-butyl-4-(3-methoxypropylamino)-~{N}-(2-methylpropyl)-~{N}-[(3~{S},5~{R})-5-morpholin-4-ylcarbonylpiperidin-3-yl]pyrimidine-5-carboxamide, DI(HYDROXYETHYL)ETHER, ... | | Authors: | Snell, G.P, Behnke, C.A, Okada, K, Hideyuki, O, Sang, B.-C, Lane, W. | | Deposit date: | 2016-07-01 | | Release date: | 2016-11-16 | | Last modified: | 2020-07-29 | | Method: | X-RAY DIFFRACTION (2.41 Å) | | Cite: | Discovery of TAK-272: A Novel, Potent, and Orally Active Renin Inhibitor.
Acs Med.Chem.Lett., 7, 2016
|
|
5KVF
 | | Zika specific antibody, ZV-64, bound to ZIKA envelope DIII | | Descriptor: | GLYCEROL, ZV-64 Antibody Fab Heavy Chain, ZV-64 Antibody Fab Light Chain, ... | | Authors: | Zhao, H, Nelson, C.A, Fremont, D.H, Center for Structural Genomics of Infectious Diseases (CSGID) | | Deposit date: | 2016-07-14 | | Release date: | 2016-08-03 | | Last modified: | 2016-08-24 | | Method: | X-RAY DIFFRACTION (1.4 Å) | | Cite: | Structural Basis of Zika Virus-Specific Antibody Protection.
Cell, 166, 2016
|
|
5KVE
 | | Zika specific antibody, ZV-48, bound to ZIKA envelope DIII | | Descriptor: | 1,2-ETHANEDIOL, ACETATE ION, Genome polyprotein, ... | | Authors: | Zhao, H, Nelson, C.A, Fremont, D.H, Center for Structural Genomics of Infectious Diseases (CSGID) | | Deposit date: | 2016-07-14 | | Release date: | 2016-08-10 | | Last modified: | 2019-12-25 | | Method: | X-RAY DIFFRACTION (1.7 Å) | | Cite: | Structural Basis of Zika Virus-Specific Antibody Protection.
Cell, 166, 2016
|
|
5KVD
 | | Zika specific antibody, ZV-2, bound to ZIKA envelope DIII | | Descriptor: | 1,2-ETHANEDIOL, 2-(N-MORPHOLINO)-ETHANESULFONIC ACID, SODIUM ION, ... | | Authors: | Zhao, H, Nelson, C.A, Fremont, D.H, Center for Structural Genomics of Infectious Diseases (CSGID) | | Deposit date: | 2016-07-14 | | Release date: | 2016-08-03 | | Last modified: | 2016-08-24 | | Method: | X-RAY DIFFRACTION (1.65 Å) | | Cite: | Structural Basis of Zika Virus-Specific Antibody Protection.
Cell, 166, 2016
|
|
5KOT
 | | Discovery of TAK-272: A Novel, Potent and Orally Active Renin In-hibitor | | Descriptor: | 1-(4-methoxybutyl)-~{N}-(2-methylpropyl)-~{N}-[(3~{S},5~{R})-5-morpholin-4-ylcarbonylpiperidin-3-yl]benzimidazole-2-carboxamide, 2-acetamido-2-deoxy-beta-D-glucopyranose, DI(HYDROXYETHYL)ETHER, ... | | Authors: | Snell, G.P, Behnke, C.A, Okada, K, Hideyuki, O, Sang, B.-C, Lane, W. | | Deposit date: | 2016-07-01 | | Release date: | 2017-07-05 | | Last modified: | 2020-07-29 | | Method: | X-RAY DIFFRACTION (2.1 Å) | | Cite: | Discovery of TAK-272: A Novel, Potent and Orally Active Renin Inhibitor
To be published
|
|
3PI3
 | | Crystallographic Structure of HbII-oxy from Lucina pectinata at pH 5.0 | | Descriptor: | Hemoglobin II, OXYGEN MOLECULE, PROTOPORPHYRIN IX CONTAINING FE | | Authors: | Gavira, J.A, Nieves-Marrero, C.A, Ruiz-Martinez, C.R, Estremera-Andujar, R.A, Lopez-Garriga, J, Garcia-Ruiz, J.M. | | Deposit date: | 2010-11-05 | | Release date: | 2011-11-09 | | Last modified: | 2023-09-06 | | Method: | X-RAY DIFFRACTION (1.95 Å) | | Cite: | pH-dependence crystallographic studies of the oxygen carrier hemoglobin II from Lucina pectinata
To be Published
|
|
1KX5
 | | X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution | | Descriptor: | CHLORIDE ION, DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), ... | | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | | Deposit date: | 2002-01-31 | | Release date: | 2002-12-25 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (1.94 Å) | | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
|
|
5KVH
 | | Crystal structure of human apoptosis-inducing factor with W196A mutation | | Descriptor: | Apoptosis-inducing factor 1, mitochondrial, FLAVIN-ADENINE DINUCLEOTIDE, ... | | Authors: | Brosey, C.A, Nix, J, Ellenberger, T, Tainer, J.A. | | Deposit date: | 2016-07-14 | | Release date: | 2016-11-16 | | Last modified: | 2023-10-04 | | Method: | X-RAY DIFFRACTION (2.273 Å) | | Cite: | Defining NADH-Driven Allostery Regulating Apoptosis-Inducing Factor.
Structure, 24, 2016
|
|
3PI2
 | | Crystallographic Structure of HbII-oxy from Lucina pectinata at pH 8.0 | | Descriptor: | FORMIC ACID, Hemoglobin II, OXYGEN MOLECULE, ... | | Authors: | Gavira, J.A, Nieves-Marrero, C.A, Ruiz-Martinez, C.R, Estremera-Andujar, R.A, Lopez-Garriga, J, Garcia-Ruiz, J.M. | | Deposit date: | 2010-11-05 | | Release date: | 2011-11-09 | | Last modified: | 2016-12-21 | | Method: | X-RAY DIFFRACTION (1.85 Å) | | Cite: | pH-dependence crystallographic studies of the oxygen carrier hemoglobin II from Lucina pectinata
To be Published
|
|
5KKZ
 | | Rhodobacter sphaeroides bc1 with famoxadone | | Descriptor: | (1R)-2-{[(R)-(2-AMINOETHOXY)(HYDROXY)PHOSPHORYL]OXY}-1-[(DODECANOYLOXY)METHYL]ETHYL (9Z)-OCTADEC-9-ENOATE, ASCORBIC ACID, Cytochrome b, ... | | Authors: | Xia, D, Esser, L, Zhou, F, Tang, W.K, Yu, C.A. | | Deposit date: | 2016-06-23 | | Release date: | 2016-10-12 | | Last modified: | 2023-09-27 | | Method: | X-RAY DIFFRACTION (2.97 Å) | | Cite: | Hydrogen Bonding to the Substrate Is Not Required for Rieske Iron-Sulfur Protein Docking to the Quinol Oxidation Site of Complex III.
J.Biol.Chem., 291, 2016
|
|
5KVI
 | | Crystal structure of monomeric human apoptosis-inducing factor with E413A/R422A/R430A mutations | | Descriptor: | 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID, Apoptosis-inducing factor 1, mitochondrial, ... | | Authors: | Brosey, C.A, Nix, J, Ellenberger, T, Tainer, J.A. | | Deposit date: | 2016-07-14 | | Release date: | 2016-11-16 | | Last modified: | 2023-10-04 | | Method: | X-RAY DIFFRACTION (1.995 Å) | | Cite: | Defining NADH-Driven Allostery Regulating Apoptosis-Inducing Factor.
Structure, 24, 2016
|
|
3PI1
 | | Crystallographic Structure of HbII-oxy from Lucina pectinata at pH 9.0 | | Descriptor: | Hemoglobin II, OXYGEN MOLECULE, PROTOPORPHYRIN IX CONTAINING FE | | Authors: | Gavira, J.A, Nieves-Marrero, C.A, Ruiz-Martinez, C.R, Estremera-Andujar, R.A, Lopez-Garriga, J, Garcia-Ruiz, J.M. | | Deposit date: | 2010-11-05 | | Release date: | 2011-11-09 | | Last modified: | 2019-07-17 | | Method: | X-RAY DIFFRACTION (2.002 Å) | | Cite: | pH-dependence crystallographic studies of the oxygen carrier hemoglobin II from Lucina pectinata
To be Published
|
|
3PI4
 | | Crystallographic Structure of HbII-oxy from Lucina pectinata at pH 4.0 | | Descriptor: | Hemoglobin II, PROTOPORPHYRIN IX CONTAINING FE | | Authors: | Gavira, J.A, Nieves-Marrero, C.A, Ruiz-Martinez, C.R, Estremera-Andujar, R.A, Lopez-Garriga, J, Garcia-Ruiz, J.M. | | Deposit date: | 2010-11-05 | | Release date: | 2011-11-09 | | Method: | X-RAY DIFFRACTION (3.17 Å) | | Cite: | pH-dependence crystallographic studies of the oxygen carrier hemoglobin II from Lucina pectinata
To be Published
|
|
5KKM
 | | Con-Vc11-22 | | Descriptor: | O2_contryphan_Vc1 prepropeptide | | Authors: | Chittoor, B, Krishnarjuna, B, MacRaild, C.A, Robinson, S.D. | | Deposit date: | 2016-06-22 | | Release date: | 2017-05-31 | | Last modified: | 2023-06-14 | | Method: | SOLUTION NMR | | Cite: | The Single Disulfide-Directed beta-Hairpin Fold. Dynamics, Stability, and Engineering.
Biochemistry, 56, 2017
|
|
5L34
 | |
5M54
 | | Mechanism of microtubule minus-end recognition and protection by CAMSAP proteins | | Descriptor: | Calmodulin-regulated spectrin-associated protein 1, GUANOSINE-5'-DIPHOSPHATE, GUANOSINE-5'-TRIPHOSPHATE, ... | | Authors: | Akhmanova, A, Moores, C.A, Baldus, M, Steinmetz, M.O, Topf, M, Roberts, A.J, Grant, B.J, Scarabelli, G, Joseph, A.-J, van Hooff, J.J.E, Houben, K, Hua, S, Luo, Y, Stangier, M.M, Jiang, K, Atherton, J. | | Deposit date: | 2016-10-20 | | Release date: | 2017-10-04 | | Last modified: | 2024-05-15 | | Method: | ELECTRON MICROSCOPY (8 Å) | | Cite: | A structural model for microtubule minus-end recognition and protection by CAMSAP proteins.
Nat. Struct. Mol. Biol., 24, 2017
|
|
5M50
 | | Mechanism of microtubule minus-end recognition and protection by CAMSAP proteins | | Descriptor: | Calmodulin-regulated spectrin-associated protein 3, GUANOSINE-5'-DIPHOSPHATE, GUANOSINE-5'-TRIPHOSPHATE, ... | | Authors: | Akhmanova, A, Moores, C.A, Baldus, M, Steinmetz, M.O, Topf, M, Roberts, A.J, Grant, B.J, Scarabelli, G, Joseph, A.-P, van Hooff, J.J.E, Houben, K, Hua, S, Luo, Y, Stangier, M.M, Jiang, K, Atherton, J. | | Deposit date: | 2016-10-20 | | Release date: | 2017-10-04 | | Last modified: | 2024-05-15 | | Method: | ELECTRON MICROSCOPY (5.3 Å) | | Cite: | A structural model for microtubule minus-end recognition and protection by CAMSAP proteins.
Nat. Struct. Mol. Biol., 24, 2017
|
|
5M5C
 | | Mechanism of microtubule minus-end recognition and protection by CAMSAP proteins | | Descriptor: | Calmodulin-regulated spectrin-associated protein 1, GUANOSINE-5'-DIPHOSPHATE, GUANOSINE-5'-TRIPHOSPHATE, ... | | Authors: | Akhmanova, A, Moores, C.A, Baldus, M, Steinmetz, M.O, Topf, M, Roberts, A.J, Grant, B.J, Scarabelli, G, Joseph, A.-P, van Hooff, J.J.E, Houben, K, Hua, S, Luo, Y, Stangier, M.M, Jiang, K, Atherton, J. | | Deposit date: | 2016-10-21 | | Release date: | 2017-10-04 | | Last modified: | 2024-05-15 | | Method: | ELECTRON MICROSCOPY (4.8 Å) | | Cite: | A structural model for microtubule minus-end recognition and protection by CAMSAP proteins.
Nat. Struct. Mol. Biol., 24, 2017
|
|
5M5N
 | | Pseudo-atomic model of microtubule-bound S.pombe kinesin-5 motor domain in the AMPPNP state (based on cryo-electron microscopy experiment): the N-terminus adopts multiple conformations. | | Descriptor: | GUANOSINE-5'-DIPHOSPHATE, GUANOSINE-5'-TRIPHOSPHATE, Kinesin-like protein cut7, ... | | Authors: | Goulet, A, Moores, C.A, Cross, R.A. | | Deposit date: | 2016-10-22 | | Release date: | 2016-11-30 | | Last modified: | 2024-05-08 | | Method: | ELECTRON MICROSCOPY (9.3 Å) | | Cite: | Schizosaccharomyces pombe kinesin-5 switches direction using a steric blocking mechanism.
Proc. Natl. Acad. Sci. U.S.A., 113, 2016
|
|
5MPT
 | | Structure of the citrinin polyketide synthase CMeT domain | | Descriptor: | 1,2-ETHANEDIOL, Citrinin polyketide synthase, S-ADENOSYL-L-HOMOCYSTEINE | | Authors: | Herbst, D.A, Storm, P.A, Townsend, C.A, Maier, T. | | Deposit date: | 2016-12-19 | | Release date: | 2017-02-22 | | Last modified: | 2024-05-08 | | Method: | X-RAY DIFFRACTION (1.648 Å) | | Cite: | Functional and Structural Analysis of Programmed C-Methylation in the Biosynthesis of the Fungal Polyketide Citrinin.
Cell Chem Biol, 24, 2017
|
|
5M5L
 | | Pseudo-atomic model of microtubule-bound S. pombe kinesin-5 motor domain in the AMPPNP state (based on cryo-electron microscopy experiment): the N-terminus adopts multiple conformations | | Descriptor: | GUANOSINE-5'-DIPHOSPHATE, GUANOSINE-5'-TRIPHOSPHATE, Kinesin-like protein cut7, ... | | Authors: | Goulet, A, Moores, C.A, Cross, R.A. | | Deposit date: | 2016-10-21 | | Release date: | 2016-11-30 | | Last modified: | 2024-05-08 | | Method: | ELECTRON MICROSCOPY (9.3 Å) | | Cite: | Schizosaccharomyces pombe kinesin-5 switches direction using a steric blocking mechanism.
Proc. Natl. Acad. Sci. U.S.A., 113, 2016
|
|
5M5I
 | | Pseudo-atomic model of microtubule-bound S.pombe kinesin-5 motor domain in the AMPPNP state (based on cryo-electron microscopy experiment): the N-terminus conformation allows formation of a cover neck bundle. | | Descriptor: | GUANOSINE-5'-DIPHOSPHATE, GUANOSINE-5'-TRIPHOSPHATE, Kinesin-like protein cut7, ... | | Authors: | Goulet, A, Moores, C.A, Cross, R.A. | | Deposit date: | 2016-10-21 | | Release date: | 2016-11-30 | | Last modified: | 2024-05-15 | | Method: | ELECTRON MICROSCOPY (9.3 Å) | | Cite: | Schizosaccharomyces pombe kinesin-5 switches direction using a steric blocking mechanism.
Proc. Natl. Acad. Sci. U.S.A., 113, 2016
|
|
5M5O
 | | Pseudo-atomic model of microtubule-bound S.pombe kinesin-5 motor domain in the AMPPNP state (based on cryo-electron microscopy experiment): the N-terminus adopts multiple conformations. | | Descriptor: | GUANOSINE-5'-DIPHOSPHATE, GUANOSINE-5'-TRIPHOSPHATE, Kinesin-like protein cut7, ... | | Authors: | Goulet, A, Moores, C.A, Cross, R.A. | | Deposit date: | 2016-10-22 | | Release date: | 2016-11-30 | | Last modified: | 2024-05-08 | | Method: | ELECTRON MICROSCOPY (9.3 Å) | | Cite: | Schizosaccharomyces pombe kinesin-5 switches direction using a steric blocking mechanism.
Proc. Natl. Acad. Sci. U.S.A., 113, 2016
|
|
