5ZVQ
 
 | |
5ZWU
 | |
1FG0
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
1ORY
 | | FLAGELLAR EXPORT CHAPERONE IN COMPLEX WITH ITS COGNATE BINDING PARTNER | | Descriptor: | Flagellin, PHOSPHATE ION, flagellar protein FliS | | Authors: | Evdokimov, A.G, Phan, J, Tropea, J.E, Routzahn, K.M, Peters III, H.K, Pokross, M, Waugh, D.S. | | Deposit date: | 2003-03-17 | | Release date: | 2003-09-16 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (2.45 Å) | | Cite: | Similar modes of polypeptide recognition by export chaperones in flagellar biosynthesis and type III secretion
Nat.Struct.Biol., 10, 2003
|
|
5X8C
 | | AMPPCP and TMP bound crystal structure of thymidylate kinase from thermus thermophilus HB8 | | Descriptor: | CHLORIDE ION, MAGNESIUM ION, PHOSPHOMETHYLPHOSPHONIC ACID ADENYLATE ESTER, ... | | Authors: | Chaudhary, S.K, Jeyakanthan, J, Sekar, K. | | Deposit date: | 2017-03-02 | | Release date: | 2018-03-14 | | Last modified: | 2023-11-22 | | Method: | X-RAY DIFFRACTION (2.07 Å) | | Cite: | Structural and functional roles of dynamically correlated residues in thymidylate kinase.
Acta Crystallogr D Struct Biol, 74, 2018
|
|
5X8J
 | |
2NAS
 | |
7YGQ
 | | Crystal structure of SARS main protease in complex with inhibitor YH-53 | | Descriptor: | 3C-like proteinase nsp5, N-[(2S)-1-[[(2S)-1-(1,3-benzothiazol-2-yl)-1-oxidanylidene-3-[(3S)-2-oxidanylidenepyrrolidin-3-yl]propan-2-yl]amino]-4-methyl-1-oxidanylidene-pentan-2-yl]-4-methoxy-1H-indole-2-carboxamide | | Authors: | Lin, C, Zhong, F.L, Zhou, X.L, Zeng, P, Zhang, J, Li, J. | | Deposit date: | 2022-07-12 | | Release date: | 2022-12-21 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (2.04 Å) | | Cite: | Structural Basis for the Inhibition of Coronaviral Main Proteases by a Benzothiazole-Based Inhibitor.
Viruses, 14, 2022
|
|
2OIG
 | | Crystal structure of RS21-C6 core segment and dm5CTP complex | | Descriptor: | 2'-DEOXY-5-METHYLCYTIDINE 5'-(TETRAHYDROGEN TRIPHOSPHATE), RS21-C6 | | Authors: | Wu, B, Liu, Y, Zhao, Q, Liao, S, Zhang, J, Bartlam, M, Chen, W, Rao, Z. | | Deposit date: | 2007-01-11 | | Release date: | 2007-03-06 | | Last modified: | 2023-10-25 | | Method: | X-RAY DIFFRACTION (3.3 Å) | | Cite: | Crystal Structure of RS21-C6, Involved in Nucleoside Triphosphate Pyrophosphohydrolysis
J.Mol.Biol., 367, 2007
|
|
7WQI
 | | Crystal structure of SARS coronavirus main protease in complex with PF07304814 | | Descriptor: | 3C-like proteinase, [(3~{S})-3-[[(2~{S})-2-[(4-methoxy-1~{H}-indol-2-yl)carbonylamino]-4-methyl-pentanoyl]amino]-2-oxidanylidene-4-[(3~{R})-2-oxidanylidene-3,4-dihydropyrrol-3-yl]butyl] dihydrogen phosphate | | Authors: | Lin, C, Zhong, F.L, Zhou, X.L, Zeng, P, Zhang, J, Li, J. | | Deposit date: | 2022-01-25 | | Release date: | 2023-01-25 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (1.93 Å) | | Cite: | Crystal structure of SARS coronavirus main protease in complex with PF07304814
To Be Published
|
|
2OIE
 | | Crystal structure of RS21-C6 core segment RSCUT | | Descriptor: | RS21-C6, SULFATE ION | | Authors: | Wu, B, Liu, Y, Zhao, Q, Liao, S, Zhang, J, Bartlam, M, Chen, W, Rao, Z. | | Deposit date: | 2007-01-10 | | Release date: | 2007-03-06 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Crystal Structure of RS21-C6, Involved in Nucleoside Triphosphate Pyrophosphohydrolysis
J.Mol.Biol., 367, 2007
|
|
5X99
 | |
4K47
 | | Structure of the Streptococcus pneumoniae leucyl-tRNA synthetase editing domain bound to a benzoxaborole-AMP adduct | | Descriptor: | Leucine--tRNA ligase, SULFATE ION, [(1R,5R,6R,8S)-6-(6-aminopurin-9-yl)-3'-[(R)-oxidanyl(phenyl)methyl]spiro[2,4,7-trioxa-3-boranuidabicyclo[3.3.0]octane-3,9'-8-oxa-9-boranuidabicyclo[4.3.0]nona-1,3,5-triene]-8-yl]methyl dihydrogen phosphate | | Authors: | Hu, Q.H, Liu, R.J, Fang, Z.P, Zhang, J, Ding, Y.Y, Tan, M, Wang, M, Pan, W, Zhou, H.C, Wang, E.D. | | Deposit date: | 2013-04-12 | | Release date: | 2013-09-04 | | Last modified: | 2024-03-20 | | Method: | X-RAY DIFFRACTION (2.02 Å) | | Cite: | Discovery of a potent benzoxaborole-based anti-pneumococcal agent targeting leucyl-tRNA synthetase
Sci Rep, 3, 2013
|
|
4K48
 | | Structure of the Streptococcus pneumoniae leucyl-tRNA synthetase editing domain | | Descriptor: | Leucine--tRNA ligase | | Authors: | Hu, Q.H, Liu, R.J, Fang, Z.P, Zhang, J, Ding, Y.Y, Tan, M, Wang, M, Pan, W, Zhou, H.C, Wang, E.D. | | Deposit date: | 2013-04-12 | | Release date: | 2013-09-04 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.49 Å) | | Cite: | Discovery of a potent benzoxaborole-based anti-pneumococcal agent targeting leucyl-tRNA synthetase
Sci Rep, 3, 2013
|
|
4GT3
 | |
4H58
 | | BRAF in complex with compound 3 | | Descriptor: | CHLORIDE ION, N-(4-{[(2-methoxyethyl)amino]methyl}phenyl)-6-(pyridin-4-yl)quinazolin-2-amine, Serine/threonine-protein kinase B-raf | | Authors: | Vasbinder, M, Aquila, B, Augustin, M, Chueng, T, Cook, D, Drew, L, Fauber, B, Glossop, S, Godin, R, Grondine, M, Hennessy, E, Johannes, J, Lee, S, Lyne, P, Moertl, M, Omer, C, Palakurthi, S, Pontz, T, Read, J, Sha, L, Shen, M, Steinbacher, S, Wang, H, Wu, A, Ye, M, Bagal, B. | | Deposit date: | 2012-09-18 | | Release date: | 2013-02-27 | | Last modified: | 2023-09-20 | | Method: | X-RAY DIFFRACTION (3.1 Å) | | Cite: | Discovery and Optimization of a Novel Series of Potent Mutant B-Raf(V600E) Selective Kinase Inhibitors.
J.Med.Chem., 56, 2013
|
|
7Y72
 | | SARS-CoV-2 spike glycoprotein trimer complexed with Fab fragment of anti-RBD antibody E7 (focused refinement on Fab-RBD interface) | | Descriptor: | Fab E7 heavy chain, Fab E7 light chain, Spike glycoprotein | | Authors: | Chia, W.N, Tan, C.W, Tan, A.W.K, Young, B, Starr, T.N, Lopez, E, Fibriansah, G, Barr, J, Cheng, S, Yeoh, A.Y.Y, Yap, W.C, Lim, B.L, Ng, T.S, Sia, W.R, Zhu, F, Chen, S, Zhang, J, Greaney, A.J, Chen, M, Au, G.G, Paradkar, P, Peiris, M, Chung, A.W, Bloom, J.D, Lye, D, Lok, S.M, Wang, L.F. | | Deposit date: | 2022-06-21 | | Release date: | 2023-08-02 | | Last modified: | 2023-08-09 | | Method: | ELECTRON MICROSCOPY (4.03 Å) | | Cite: | Potent pan huACE2-dependent sarbecovirus neutralizing monoclonal antibodies isolated from a BNT162b2-vaccinated SARS survivor.
Sci Adv, 9, 2023
|
|
7Y71
 | | SARS-CoV-2 spike glycoprotein trimer complexed with Fab fragment of anti-RBD antibody E7 | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, Fab E7 heavy chain, ... | | Authors: | Chia, W.N, Tan, C.W, Tan, A.W.K, Young, B, Starr, T.N, Lopez, E, Fibriansah, G, Barr, J, Cheng, S, Yeoh, A.Y.Y, Yap, W.C, Lim, B.L, Ng, T.S, Sia, W.R, Zhu, F, Chen, S, Zhang, J, Greaney, A.J, Chen, M, Au, G.G, Paradkar, P, Peiris, M, Chung, A.W, Bloom, J.D, Lye, D, Lok, S.M, Wang, L.F. | | Deposit date: | 2022-06-21 | | Release date: | 2023-08-02 | | Last modified: | 2023-08-09 | | Method: | ELECTRON MICROSCOPY (3.12 Å) | | Cite: | Potent pan huACE2-dependent sarbecovirus neutralizing monoclonal antibodies isolated from a BNT162b2-vaccinated SARS survivor.
Sci Adv, 9, 2023
|
|
7WQH
 | | Crystal structure of HCoV-NL63 main protease with PF07304814 | | Descriptor: | 3C-like proteinase, [(3~{S})-3-[[(2~{S})-2-[(4-methoxy-1~{H}-indol-2-yl)carbonylamino]-4-methyl-pentanoyl]amino]-2-oxidanylidene-4-[(3~{R})-2-oxidanylidene-3,4-dihydropyrrol-3-yl]butyl] dihydrogen phosphate | | Authors: | Zhong, F.L, Zhou, X.L, Lin, C, Zeng, P, Li, J, Zhang, J. | | Deposit date: | 2022-01-25 | | Release date: | 2022-08-24 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (2.32 Å) | | Cite: | Structural Basis of Main Proteases of Coronavirus Bound to Drug Candidate PF-07304814
J.Mol.Biol., 434, 2022
|
|
4N19
 | | Structural basis of conformational transitions in the active site and 80 s loop in the FK506 binding protein FKBP12 | | Descriptor: | Peptidyl-prolyl cis-trans isomerase FKBP1A, SULFATE ION | | Authors: | Mustafi, S.M, Brecher, M.B, Zhang, J, Li, H.M, Lemaster, D.M, Hernandez, G. | | Deposit date: | 2013-10-03 | | Release date: | 2014-02-12 | | Last modified: | 2023-09-20 | | Method: | X-RAY DIFFRACTION (1.2 Å) | | Cite: | Structural basis of conformational transitions in the active site and 80's loop in the FK506-binding protein FKBP12.
Biochem.J., 458, 2014
|
|
7WQJ
 | | Crystal structure of MERS main protease in complex with PF07304814 | | Descriptor: | 3C-like proteinase, [(3~{S})-3-[[(2~{S})-2-[(4-methoxy-1~{H}-indol-2-yl)carbonylamino]-4-methyl-pentanoyl]amino]-2-oxidanylidene-4-[(3~{R})-2-oxidanylidene-3,4-dihydropyrrol-3-yl]butyl] dihydrogen phosphate | | Authors: | Lin, C, Zhang, J, Li, J. | | Deposit date: | 2022-01-25 | | Release date: | 2022-08-24 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (2.75 Å) | | Cite: | Structural Basis of Main Proteases of Coronavirus Bound to Drug Candidate PF-07304814
J.Mol.Biol., 434, 2022
|
|
7XRY
 | | Crystal structure of MERS main protease in complex with inhibitor YH-53 | | Descriptor: | N-[(2S)-1-[[(2S)-1-(1,3-benzothiazol-2-yl)-1-oxidanylidene-3-[(3S)-2-oxidanylidenepyrrolidin-3-yl]propan-2-yl]amino]-4-methyl-1-oxidanylidene-pentan-2-yl]-4-methoxy-1H-indole-2-carboxamide, ORF1a | | Authors: | Lin, C, Zhong, F.L, Zhou, X.L, Li, J, Zhang, J. | | Deposit date: | 2022-05-12 | | Release date: | 2022-12-21 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (1.99 Å) | | Cite: | Structural Basis for the Inhibition of Coronaviral Main Proteases by a Benzothiazole-Based Inhibitor.
Viruses, 14, 2022
|
|
7XRS
 | | Crystal structure of SARS-Cov-2 main protease in complex with inhibitor YH-53 | | Descriptor: | N-[(2S)-1-[[(2S)-1-(1,3-benzothiazol-2-yl)-1-oxidanylidene-3-[(3S)-2-oxidanylidenepyrrolidin-3-yl]propan-2-yl]amino]-4-methyl-1-oxidanylidene-pentan-2-yl]-4-methoxy-1H-indole-2-carboxamide, Replicase polyprotein 1a | | Authors: | Zhou, X.L, Zhong, F.L, Lin, C, Zeng, P, Zhang, J, Li, J. | | Deposit date: | 2022-05-11 | | Release date: | 2022-12-21 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (1.93 Å) | | Cite: | Structural Basis for the Inhibition of Coronaviral Main Proteases by a Benzothiazole-Based Inhibitor.
Viruses, 14, 2022
|
|
1N4K
 | | Crystal structure of the inositol 1,4,5-trisphosphate receptor binding core in complex with IP3 | | Descriptor: | D-MYO-INOSITOL-1,4,5-TRIPHOSPHATE, Inositol 1,4,5-trisphosphate receptor type 1 | | Authors: | Bosanac, I, Alattia, J.R, Mal, T.K, Chan, J, Talarico, S, Tong, F.K, Tong, K.I, Yoshikawa, F, Furuichi, T, Iwai, M, Michikawa, T, Mikoshiba, K, Ikura, M. | | Deposit date: | 2002-10-31 | | Release date: | 2002-12-25 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Structure of the inositol 1,4,5-trisphosphate receptor
binding core in complex with its ligand.
Nature, 420, 2002
|
|
2LTH
 | | NMR structure of major ampullate spidroin 1 N-terminal domain at pH 5.5 | | Descriptor: | Major ampullate spidroin 1 | | Authors: | Otikovs, M, Jaudzems, K, Nordling, K, Landreh, M, Rising, A, Askarieh, G, Knight, S, Johansson, J. | | Deposit date: | 2012-05-25 | | Release date: | 2013-11-27 | | Last modified: | 2024-05-15 | | Method: | SOLUTION NMR | | Cite: | Sequential pH-driven dimerization and stabilization of the N-terminal domain enables rapid spider silk formation.
Nat Commun, 5, 2014
|
|
