274D
 
 | | CRYSTAL STRUCTURE OF A COVALENT DNA-DRUG ADDUCT: ANTHRAMYCIN BOUND TO C-C-A-A-C-G-T-T-G-G, AND A MOLECULAR EXPLANATION OF SPECIFICITY | | Descriptor: | ANTHRAMYCIN, DNA (5'-D(*CP*CP*AP*AP*CP*GP*TP*TP*(DRUG)GP*G)-3') | | Authors: | Kopka, M.L, Goodsell, D.S, Baikalov, I, Grzeskowiak, K, Cascio, D, Dickerson, R.E. | | Deposit date: | 1994-04-28 | | Release date: | 1994-10-21 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.3 Å) | | Cite: | Crystal structure of a covalent DNA-drug adduct: anthramycin bound to C-C-A-A-C-G-T-T-G-G and a molecular explanation of specificity.
Biochemistry, 33, 1994
|
|
5IM5
 | | Crystal structure of designed two-component self-assembling icosahedral cage I53-40 | | Descriptor: | Designed Keto-hydroxyglutarate-aldolase/keto-deoxy-phosphogluconate aldolase, Designed Riboflavin synthase | | Authors: | Liu, Y.A, Cascio, D, Sawaya, M.R, Bale, J.B, Collazo, M.J, Thomas, C, Sheffler, W, King, N.P, Baker, D, Yeates, T.O. | | Deposit date: | 2016-03-05 | | Release date: | 2016-07-27 | | Last modified: | 2023-09-27 | | Method: | X-RAY DIFFRACTION (3.699 Å) | | Cite: | Accurate design of megadalton-scale two-component icosahedral protein complexes.
Science, 353, 2016
|
|
5IM4
 | | Crystal structure of designed two-component self-assembling icosahedral cage I52-32 | | Descriptor: | 6,7-dimethyl-8-ribityllumazine synthase, Phosphotransferase system, mannose/fructose-specific component IIA | | Authors: | Liu, Y.A, Cascio, D, Sawaya, M.R, Bale, J.B, Collazo, M.J, Thomas, C, Sheffler, W, King, N.P, Baker, D, Yeates, T.O. | | Deposit date: | 2016-03-05 | | Release date: | 2016-07-27 | | Last modified: | 2023-09-27 | | Method: | X-RAY DIFFRACTION (3.5 Å) | | Cite: | Accurate design of megadalton-scale two-component icosahedral protein complexes.
Science, 353, 2016
|
|
5IM6
 | | Crystal structure of designed two-component self-assembling icosahedral cage I32-28 | | Descriptor: | Designed self-assembling icosahedral cage I32-28 dimeric subunit, Designed self-assembling icosahedral cage I32-28 trimeric subunit | | Authors: | Liu, Y.A, Cascio, D, Sawaya, M.R, Bale, J.B, Collazo, M.J, Thomas, C, Sheffler, W, King, N.P, Baker, D, Yeates, T.O. | | Deposit date: | 2016-03-05 | | Release date: | 2016-07-27 | | Last modified: | 2023-09-27 | | Method: | X-RAY DIFFRACTION (5.588 Å) | | Cite: | Accurate design of megadalton-scale two-component icosahedral protein complexes.
Science, 353, 2016
|
|
307D
 | | Structure of a DNA analog of the primer for HIV-1 RT second strand synthesis | | Descriptor: | DNA (5'-D(*CP*AP*AP*AP*GP*AP*AP*AP*AP*G)-3'), DNA (5'-D(*CP*TP*TP*TP*TP*CP*TP*TP*TP*G)-3') | | Authors: | Han, G.W, Kopka, M.L, Cascio, D, Grzeskowiak, K, Dickerson, R.E. | | Deposit date: | 1997-01-07 | | Release date: | 1997-01-27 | | Last modified: | 2024-04-03 | | Method: | X-RAY DIFFRACTION (1.85 Å) | | Cite: | Structure of a DNA analog of the primer for HIV-1 RT second strand synthesis.
J.Mol.Biol., 269, 1997
|
|
2OG0
 | | Crystal Structure of the Lambda Xis-DNA complex | | Descriptor: | 5'-D(*AP*AP*AP*CP*AP*GP*AP*CP*TP*AP*CP*AP*TP*AP*AP*TP*AP*C)-3', 5'-D(*GP*TP*AP*TP*TP*AP*TP*GP*TP*AP*GP*TP*CP*TP*GP*TP*TP*T)-3', Excisionase | | Authors: | Papagiannis, C.V, Sam, M.D, Abbani, M.A, Cascio, D, Yoo, D, Clubb, R.T, Johnson, R.C. | | Deposit date: | 2007-01-04 | | Release date: | 2007-03-13 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | Fis targets assembly of the xis nucleoprotein filament to promote excisive recombination by phage lambda.
J.Mol.Biol., 367, 2007
|
|
5K7P
 | | MicroED structure of xylanase at 2.3 A resolution | | Descriptor: | Endo-1,4-beta-xylanase 2, IODIDE ION | | Authors: | de la Cruz, M.J, Hattne, J, Shi, D, Seidler, P, Rodriguez, J, Reyes, F.E, Sawaya, M.R, Cascio, D, Eisenberg, D, Gonen, T. | | Deposit date: | 2016-05-26 | | Release date: | 2017-04-05 | | Last modified: | 2024-02-28 | | Method: | ELECTRON CRYSTALLOGRAPHY (2.3 Å) | | Cite: | Atomic-resolution structures from fragmented protein crystals with the cryoEM method MicroED.
Nat. Methods, 14, 2017
|
|
3DBO
 | | Crystal structure of a member of the VapBC family of toxin-antitoxin systems, VapBC-5, from Mycobacterium tuberculosis | | Descriptor: | ACETATE ION, BETA-MERCAPTOETHANOL, SODIUM ION, ... | | Authors: | Miallau, L, Cascio, D, Eisenberg, D, Integrated Center for Structure and Function Innovation (ISFI), TB Structural Genomics Consortium (TBSGC) | | Deposit date: | 2008-06-02 | | Release date: | 2008-07-15 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (1.76 Å) | | Cite: | Structure and Proposed Activity of a Member of the VapBC Family of Toxin-Antitoxin Systems: VapBC-5 FROM MYCOBACTERIUM TUBERCULOSIS.
J.Biol.Chem., 284, 2009
|
|
1PK1
 | | Hetero SAM domain structure of Ph and Scm. | | Descriptor: | Polyhomeotic-proximal chromatin protein, Sex comb on midleg CG9495-PA | | Authors: | Kim, C.A, Sawaya, M.R, Cascio, D, Kim, W, Bowie, J.U. | | Deposit date: | 2003-06-04 | | Release date: | 2005-02-15 | | Last modified: | 2024-11-06 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Structural organization of a Sex-comb-on-midleg/polyhomeotic copolymer.
J.Biol.Chem., 280, 2005
|
|
1PK3
 | | Scm SAM domain | | Descriptor: | BETA-MERCAPTOETHANOL, Sex comb on midleg CG9495-PA | | Authors: | Kim, C.A, Sawaya, M.R, Cascio, D, Kim, W, Bowie, J.U. | | Deposit date: | 2003-06-04 | | Release date: | 2005-02-15 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (1.85 Å) | | Cite: | Structural organization of a Sex-comb-on-midleg/polyhomeotic copolymer.
J.Biol.Chem., 280, 2005
|
|
4ZNN
 | | MicroED structure of the segment, GVVHGVTTVA, from the A53T familial mutant of Parkinson's disease protein, alpha-synuclein residues 47-56 | | Descriptor: | Alpha-synuclein | | Authors: | Rodriguez, J.A, Ivanova, M, Sawaya, M.R, Cascio, D, Reyes, F, Shi, D, Johnson, L, Guenther, E, Sangwan, S, Hattne, J, Nannenga, B, Brewster, A.S, Messerschmidt, M, Boutet, S, Sauter, N.K, Gonen, T, Eisenberg, D.S. | | Deposit date: | 2015-05-05 | | Release date: | 2015-09-09 | | Last modified: | 2024-03-06 | | Method: | ELECTRON CRYSTALLOGRAPHY (1.41 Å) | | Cite: | Structure of the toxic core of alpha-synuclein from invisible crystals.
Nature, 525, 2015
|
|
5VOS
 | | VGSNKGAIIGL from Amyloid Beta determined by MicroED | | Descriptor: | Amyloid beta A4 protein | | Authors: | Rodriguez, J.A, Sawaya, M.R, Cascio, D, Eisenberg, D.S, Griner, S.L, Gonen, T. | | Deposit date: | 2017-05-03 | | Release date: | 2018-01-03 | | Last modified: | 2024-03-13 | | Method: | ELECTRON CRYSTALLOGRAPHY (1.42 Å) | | Cite: | Common fibrillar spines of amyloid-beta and human islet amyloid polypeptide revealed by microelectron diffraction and structure-based inhibitors.
J. Biol. Chem., 293, 2018
|
|
1RH6
 | | Bacteriophage Lambda Excisionase (Xis)-DNA Complex | | Descriptor: | 5'-D(*CP*TP*AP*TP*GP*TP*AP*GP*TP*CP*TP*GP*TP*TP*G)-3', 5'-D(P*CP*AP*AP*CP*AP*GP*AP*CP*TP*AP*CP*AP*TP*AP*G)-3', Excisionase | | Authors: | Sam, M.D, Cascio, D, Johnson, R.C, Clubb, R.T. | | Deposit date: | 2003-11-13 | | Release date: | 2004-06-29 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (1.7 Å) | | Cite: | Crystal structure of the excisionase-DNA complex from bacteriophage lambda.
J.Mol.Biol., 338, 2004
|
|
4M5T
 | | Disulfide trapped human alphaB crystallin core domain in complex with C-terminal peptide | | Descriptor: | Alpha-crystallin B chain, SULFATE ION | | Authors: | Laganowsky, A, Cascio, D, Hochberg, G, Sawaya, M.R, Benesch, J.L.P, Robinson, C.V, Eisenberg, D. | | Deposit date: | 2013-08-08 | | Release date: | 2014-04-09 | | Last modified: | 2024-11-20 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | The structured core domain of alpha B-crystallin can prevent amyloid fibrillation and associated toxicity.
Proc.Natl.Acad.Sci.USA, 111, 2014
|
|
5HS0
 | | Computationally Designed Cyclic Tetramer ank1C4_7 | | Descriptor: | Ankyrin domain protein ank1C4_7, GLYCEROL, SULFATE ION | | Authors: | McNamara, D.E, Cascio, D, Fallas, J.A, Baker, D, Yeates, T.O. | | Deposit date: | 2016-01-24 | | Release date: | 2017-04-12 | | Last modified: | 2023-09-27 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Computational design of self-assembling cyclic protein homo-oligomers.
Nat Chem, 9, 2017
|
|
4MJH
 | |
2IGC
 | | Structure of Spin labeled T4 Lysozyme Mutant T115R1A | | Descriptor: | Lysozyme, S-[(1-oxyl-2,2,5,5-tetramethyl-2,5-dihydro-1H-pyrrol-3-yl)methyl] methanesulfonothioate | | Authors: | Guo, Z, Cascio, D, Hideg, K, Hubbell, W.L. | | Deposit date: | 2006-09-22 | | Release date: | 2007-06-12 | | Last modified: | 2024-11-20 | | Method: | X-RAY DIFFRACTION (1.4 Å) | | Cite: | Structural determinants of nitroxide motion in spin-labeled proteins: Tertiary contact and solvent-inaccessible sites in helix G of T4 lysozyme.
Protein Sci., 16, 2007
|
|
5FOZ
 | | De novo structure of the binary mosquito larvicide BinAB at pH 10 | | Descriptor: | LARVICIDAL TOXIN PROTEIN, SODIUM ION, TOXIN | | Authors: | Colletier, J.P, Sawaya, M.R, Gingery, M, Rodriguez, J.A, Cascio, D, Brewster, A.S, Michels-Clark, T, Boutet, S, Williams, G.J, Messerschmidt, M, DePonte, D.P, Sierra, R.G, Laksmono, H, Koglin, J.E, Hunter, M.S, W Park, H, Uervirojnangkoorn, M, Bideshi, D.L, Brunger, A.T, Federici, B.A, Sauter, N.K, Eisenberg, D.S. | | Deposit date: | 2015-11-26 | | Release date: | 2016-10-05 | | Last modified: | 2024-11-06 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | De Novo Phasing with X-Ray Laser Reveals Mosquito Larvicide Binab Structure.
Nature, 539, 2016
|
|
4M5S
 | | Human alphaB crystallin core domain in complex with C-terminal peptide | | Descriptor: | Alpha-crystallin B chain, SUCCINIC ACID | | Authors: | Laganowsky, A, Cascio, D, Sawaya, M.R, Eisenberg, D. | | Deposit date: | 2013-08-08 | | Release date: | 2014-04-09 | | Last modified: | 2024-02-28 | | Method: | X-RAY DIFFRACTION (1.37 Å) | | Cite: | The structured core domain of alpha B-crystallin can prevent amyloid fibrillation and associated toxicity.
Proc.Natl.Acad.Sci.USA, 111, 2014
|
|
5FOY
 | | De novo structure of the binary mosquito larvicide BinAB at pH 7 | | Descriptor: | 41.9 KDA INSECTICIDAL TOXIN, LARVICIDAL TOXIN 51 KDA PROTEIN | | Authors: | Colletier, J.P, Sawaya, M.R, Gingery, M, Rodriguez, J.A, Cascio, D, Brewster, A.S, Michels-Clark, T, Boutet, S, Williams, G.J, Messerschmidt, M, DePonte, D.P, Sierra, R.G, Laksmono, H, Koglin, J.E, Hunter, M.S, W Park, H, Uervirojnangkoorn, M, Bideshi, D.L, Brunger, A.T, Federici, B.A, Sauter, N.K, Eisenberg, D.S. | | Deposit date: | 2015-11-26 | | Release date: | 2016-10-05 | | Last modified: | 2024-11-13 | | Method: | X-RAY DIFFRACTION (2.25 Å) | | Cite: | De Novo Phasing with X-Ray Laser Reveals Mosquito Larvicide Binab Structure.
Nature, 539, 2016
|
|
1SLH
 | | Mycobacterium tuberculosis dUTPase complexed with magnesium and dUDP | | Descriptor: | 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, DEOXYURIDINE-5'-DIPHOSPHATE, Deoxyuridine 5'-triphosphate nucleotidohydrolase, ... | | Authors: | Sawaya, M.R, Chan, S, Segelke, B, Lekin, T, Krupka, H, Cho, U.S, Kim, M.-Y, So, M, Kim, C.-Y, Naranjo, C.M, Rogers, Y.C, Park, M.S, Waldo, G.S, Pashkov, I, Cascio, D, Yeates, T.O, Perry, J.L, Terwilliger, T.C, Eisenberg, D, TB Structural Genomics Consortium (TBSGC) | | Deposit date: | 2004-03-05 | | Release date: | 2004-03-16 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | Crystal structure of the Mycobacterium tuberculosis dUTPase: insights into the catalytic mechanism.
J.Mol.Biol., 341, 2004
|
|
2IEF
 | | Structure of the cooperative Excisionase (Xis)-DNA complex reveals a micronucleoprotein filament | | Descriptor: | 15-mer DNA, 19-mer DNA, 34-mer DNA, ... | | Authors: | Abbani, M.A, Papagiannis, C.V, Sam, M.D, Cascio, D, Johnson, R.C, Clubb, R.T. | | Deposit date: | 2006-09-18 | | Release date: | 2007-02-06 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (2.601 Å) | | Cite: | Structure of the cooperative Xis-DNA complex reveals a micronucleoprotein filament that regulates phage lambda intasome assembly.
Proc.Natl.Acad.Sci.Usa, 104, 2007
|
|
1SNF
 | | MYCOBACTERIUM TUBERCULOSIS DUTPASE COMPLEXED WITH MAGNESIUM AND DEOXYURIDINE 5'-MONOPHOSPHATE | | Descriptor: | 2'-DEOXYURIDINE 5'-MONOPHOSPHATE, 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, Deoxyuridine 5'-triphosphate nucleotidohydrolase, ... | | Authors: | Sawaya, M.R, Chan, S, Segelke, B, Lekin, T, Krupka, H, Cho, U.S, Kim, M.-Y, So, M, Kim, C.-Y, Naranjo, C.M, Rogers, Y.C, Park, M.S, Waldo, G.S, Pashkov, I, Cascio, D, Yeates, T.O, Perry, J.L, Terwilliger, T.C, Eisenberg, D, TB Structural Genomics Consortium (TBSGC) | | Deposit date: | 2004-03-10 | | Release date: | 2004-03-16 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (1.85 Å) | | Cite: | Crystal structure of the Mycobacterium tuberculosis dUTPase: insights into the catalytic mechanism.
J.Mol.Biol., 341, 2004
|
|
1SIX
 | | Mycobacterium tuberculosis dUTPase complexed with magnesium and alpha,beta-imido-dUTP | | Descriptor: | 2'-DEOXYURIDINE 5'-ALPHA,BETA-IMIDO-TRIPHOSPHATE, 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, Deoxyuridine 5'-triphosphate nucleotidohydrolase, ... | | Authors: | Sawaya, M.R, Chan, S, Segelke, B, Lekin, T, Krupka, H, Cho, U.-S, Kim, M, So, M, Kim, C.-Y, Naranjo, C.M, Rogers, Y.C, Park, M.S, Waldo, G.S, Pashkov, I, Cascio, D, Yeates, T.O, Perry, J.L, Terwilliger, T.C, Eisenberg, D, TB Structural Genomics Consortium (TBSGC) | | Deposit date: | 2004-03-01 | | Release date: | 2004-03-09 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (1.3 Å) | | Cite: | Crystal structure of the Mycobacterium tuberculosis dUTPase: insights into the catalytic mechanism.
J.Mol.Biol., 341, 2004
|
|
5E3M
 | | Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) | | Descriptor: | DNA (27-MER), DNA-binding protein Fis | | Authors: | Stella, S, Hancock, S.P, Cascio, D, Johnson, R.C. | | Deposit date: | 2015-10-03 | | Release date: | 2016-03-09 | | Last modified: | 2024-05-22 | | Method: | X-RAY DIFFRACTION (2.886 Å) | | Cite: | DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.
Plos One, 11, 2016
|
|
