4DSQ
 
 | | Crystal structure of peroxiredoxin Ahp1 from Saccharomyces cerevisiae in oxidized form | | Descriptor: | Peroxiredoxin type-2 | | Authors: | Lian, F.M, Yu, J, Ma, X.X, Yu, X.J, Chen, Y, Zhou, C.Z. | | Deposit date: | 2012-02-19 | | Release date: | 2012-04-11 | | Last modified: | 2024-10-30 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Structural Snapshots of Yeast Alkyl Hydroperoxide Reductase Ahp1 Peroxiredoxin Reveal a Novel Two-cysteine Mechanism of Electron Transfer to Eliminate Reactive Oxygen Species
J.Biol.Chem., 287, 2012
|
|
9IK0
 | | Crystal structure of PrfaH encoded by IncX3 plasmids | | Descriptor: | GLYCEROL, MAGNESIUM ION, Transcription antitermination protein RfaH | | Authors: | Yang, J, Lu, Y, Yu, J, Cai, X, Wang, C, Lv, L, Liu, J. | | Deposit date: | 2024-06-26 | | Release date: | 2025-03-19 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Comprehensive analysis of Enterobacteriaceae IncX plasmids reveals robust conjugation regulators PrfaH, H-NS, and conjugation-fitness tradeoff.
Commun Biol, 8, 2025
|
|
4DSR
 | | Crystal structure of peroxiredoxin Ahp1 from Saccharomyces cerevisiae in reduced form | | Descriptor: | Peroxiredoxin type-2 | | Authors: | Lian, F.M, Yu, J, Ma, X.X, Yu, X.J, Chen, Y, Zhou, C.Z. | | Deposit date: | 2012-02-19 | | Release date: | 2012-04-11 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.91 Å) | | Cite: | Structural Snapshots of Yeast Alkyl Hydroperoxide Reductase Ahp1 Peroxiredoxin Reveal a Novel Two-cysteine Mechanism of Electron Transfer to Eliminate Reactive Oxygen Species.
J.Biol.Chem., 287, 2012
|
|
5ZUE
 | | GTP-bound, double-stranded, curved FtsZ protofilament structure | | Descriptor: | Cell division protein FtsZ, GUANOSINE-5'-TRIPHOSPHATE | | Authors: | Guan, F, Yu, J, Yu, J, Liu, Y, Li, Y, Feng, X.H, Huang, K.C, Chang, Z, Ye, S. | | Deposit date: | 2018-05-07 | | Release date: | 2018-07-04 | | Last modified: | 2024-03-27 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Lateral interactions between protofilaments of the bacterial tubulin homolog FtsZ are essential for cell division
Elife, 7, 2018
|
|
9GAW
 | | High-resolution structure of the Anaphase-promoting complex/cyclosome (APC/C) bound to co-activator Cdh1 | | Descriptor: | Anaphase-promoting complex subunit 1, Anaphase-promoting complex subunit 10, Anaphase-promoting complex subunit 11, ... | | Authors: | Hoefler, A, Yu, J, Chang, L, Zhang, Z, Yang, J, Boland, A, Barford, D. | | Deposit date: | 2024-07-29 | | Release date: | 2024-08-14 | | Last modified: | 2025-01-29 | | Method: | ELECTRON MICROSCOPY (2.9 Å) | | Cite: | Cryo-EM structures of apo-APC/C and APC/C CDH1:EMI1 complexes provide insights into APC/C regulation.
Nat Commun, 15, 2024
|
|
3B5X
 | | Crystal Structure of MsbA from Vibrio cholerae | | Descriptor: | Lipid A export ATP-binding/permease protein msbA | | Authors: | Ward, A, Reyes, C.L, Yu, J, Roth, C.B, Chang, G. | | Deposit date: | 2007-10-26 | | Release date: | 2007-12-04 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (5.5 Å) | | Cite: | Flexibility in the ABC transporter MsbA: Alternating access with a twist.
Proc.Natl.Acad.Sci.Usa, 104, 2007
|
|
3B5Z
 | | Crystal Structure of MsbA from Salmonella typhimurium with ADP Vanadate | | Descriptor: | ADENOSINE-5'-DIPHOSPHATE, Lipid A export ATP-binding/permease protein msbA, VANADATE ION | | Authors: | Ward, A, Reyes, C.L, Yu, J, Roth, C.B, Chang, G. | | Deposit date: | 2007-10-26 | | Release date: | 2007-12-04 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (4.2 Å) | | Cite: | Flexibility in the ABC transporter MsbA: Alternating access with a twist.
Proc.Natl.Acad.Sci.Usa, 104, 2007
|
|
3B5W
 | | Crystal Structure of Eschericia coli MsbA | | Descriptor: | Lipid A export ATP-binding/permease protein msbA | | Authors: | Ward, A, Reyes, C.L, Yu, J, Roth, C.B, Chang, G. | | Deposit date: | 2007-10-26 | | Release date: | 2007-12-04 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (5.3 Å) | | Cite: | Flexibility in the ABC transporter MsbA: Alternating access with a twist.
Proc.Natl.Acad.Sci.Usa, 104, 2007
|
|
3B60
 | | Crystal Structure of MsbA from Salmonella typhimurium with AMPPNP, higher resolution form | | Descriptor: | Lipid A export ATP-binding/permease protein msbA, PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER | | Authors: | Ward, A, Reyes, C.L, Yu, J, Roth, C.B, Chang, G. | | Deposit date: | 2007-10-26 | | Release date: | 2007-12-04 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (3.7 Å) | | Cite: | Flexibility in the ABC transporter MsbA: Alternating access with a twist.
Proc.Natl.Acad.Sci.Usa, 104, 2007
|
|
3B5Y
 | | Crystal Structure of MsbA from Salmonella typhimurium with AMPPNP | | Descriptor: | Lipid A export ATP-binding/permease protein msbA, PHOSPHOAMINOPHOSPHONIC ACID-ADENYLATE ESTER | | Authors: | Ward, A, Reyes, C.L, Yu, J, Roth, C.B, Chang, G. | | Deposit date: | 2007-10-26 | | Release date: | 2007-12-04 | | Last modified: | 2024-02-21 | | Method: | X-RAY DIFFRACTION (4.5 Å) | | Cite: | Flexibility in the ABC transporter MsbA: Alternating access with a twist.
Proc.Natl.Acad.Sci.Usa, 104, 2007
|
|
9KQF
 | | Cryo-EM structure of PSS1 in the absence of calcium or L-serine | | Descriptor: | 1,2-DICAPROYL-SN-PHOSPHATIDYL-L-SERINE, 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine, DODECANE, ... | | Authors: | Ning, Y, Yu, J, Ge, J. | | Deposit date: | 2024-11-25 | | Release date: | 2025-04-02 | | Method: | ELECTRON MICROSCOPY (3.25 Å) | | Cite: | Structural basis for catalytic mechanism of human phosphatidylserine synthase 1.
Cell Discov, 11, 2025
|
|
9KQI
 | | Cryo-EM structure of PSS1 with calcium | | Descriptor: | 1,2-DICAPROYL-SN-PHOSPHATIDYL-L-SERINE, 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine, CALCIUM ION, ... | | Authors: | Ning, Y, Yu, J, Ge, J. | | Deposit date: | 2024-11-26 | | Release date: | 2025-04-02 | | Method: | ELECTRON MICROSCOPY (3.02 Å) | | Cite: | Structural basis for catalytic mechanism of human phosphatidylserine synthase 1.
Cell Discov, 11, 2025
|
|
9KQJ
 | | Cryo-EM structure of PSS1 with calcium | | Descriptor: | 1,2-DICAPROYL-SN-PHOSPHATIDYL-L-SERINE, 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine, CALCIUM ION, ... | | Authors: | Ning, Y, Yu, J, Ge, J. | | Deposit date: | 2024-11-26 | | Release date: | 2025-04-02 | | Method: | ELECTRON MICROSCOPY (2.95 Å) | | Cite: | Structural basis for catalytic mechanism of human phosphatidylserine synthase 1.
Cell Discov, 11, 2025
|
|
3GX8
 | | Structural and biochemical characterization of yeast monothiol glutaredoxin Grx5 | | Descriptor: | Monothiol glutaredoxin-5, mitochondrial, SULFATE ION | | Authors: | Wang, Y, He, Y.X, Yu, J, Xiong, Y, Chen, Y, Zhou, C.Z. | | Deposit date: | 2009-04-01 | | Release date: | 2010-04-14 | | Last modified: | 2023-11-01 | | Method: | X-RAY DIFFRACTION (1.673 Å) | | Cite: | Structural and biochemical characterization of yeast monothiol glutaredoxin Grx5
To be Published
|
|
3CMI
 | |
7Y8R
 | | The nucleosome-bound human PBAF complex | | Descriptor: | ACTB protein (Fragment), ADENOSINE-5'-DIPHOSPHATE, AT-rich interactive domain-containing protein 2, ... | | Authors: | Wang, L, Yu, J, Yu, Z, Wang, Q, He, S, Xu, Y. | | Deposit date: | 2022-06-24 | | Release date: | 2022-12-07 | | Last modified: | 2024-07-03 | | Method: | ELECTRON MICROSCOPY (4.4 Å) | | Cite: | Structure of nucleosome-bound human PBAF complex.
Nat Commun, 13, 2022
|
|
2M80
 | | Solution structure of yeast dithiol glutaredoxin Grx8 | | Descriptor: | Glutaredoxin-8 | | Authors: | Tang, Y, Zhang, J, Yu, J, Wu, J, Zhou, C.Z, Shi, Y. | | Deposit date: | 2013-05-02 | | Release date: | 2014-05-07 | | Last modified: | 2024-05-01 | | Method: | SOLUTION NMR | | Cite: | Structure-guided activity enhancement and catalytic mechanism of yeast grx8
Biochemistry, 53, 2014
|
|
6PT2
 | | Crystal structure of the active delta opioid receptor in complex with the peptide agonist KGCHM07 | | Descriptor: | (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, CHOLESTEROL, Delta opioid receptor, ... | | Authors: | Claff, T, Yu, J, Blais, V, Patel, N, Martin, C, Wu, L, Han, G.W, Holleran, B.J, Van der Poorten, O, Hanson, M.A, Sarret, P, Gendron, L, Cherezov, V, Katritch, V, Ballet, S, Liu, Z, Muller, C.E, Stevens, R.C. | | Deposit date: | 2019-07-14 | | Release date: | 2019-12-11 | | Last modified: | 2024-11-06 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Elucidating the active delta-opioid receptor crystal structure with peptide and small-molecule agonists.
Sci Adv, 5, 2019
|
|
6PT3
 | | Crystal structure of the active delta opioid receptor in complex with the small molecule agonist DPI-287 | | Descriptor: | 4-[(R)-[(2S,5R)-4-benzyl-2,5-dimethylpiperazin-1-yl](3-hydroxyphenyl)methyl]-N,N-diethylbenzamide, Delta opioid receptor | | Authors: | Claff, T, Yu, J, Blais, V, Patel, N, Martin, C, Wu, L, Han, G.W, Holleran, B.J, Van der Poorten, O, Hanson, M.A, Sarret, P, Gendron, L, Cherezov, V, Katritch, V, Ballet, S, Liu, Z, Muller, C.E, Stevens, R.C. | | Deposit date: | 2019-07-14 | | Release date: | 2019-12-11 | | Last modified: | 2024-11-06 | | Method: | X-RAY DIFFRACTION (3.3 Å) | | Cite: | Elucidating the active delta-opioid receptor crystal structure with peptide and small-molecule agonists.
Sci Adv, 5, 2019
|
|
3L4N
 | | Crystal structure of yeast monothiol glutaredoxin Grx6 | | Descriptor: | GLUTATHIONE, Monothiol glutaredoxin-6 | | Authors: | Luo, M, Jiang, Y.-L, Ma, X.-X, He, Y.-X, Tang, Y.-J, Yu, J, Zhang, R.-G, Chen, Y, Zhou, C.-Z. | | Deposit date: | 2009-12-21 | | Release date: | 2010-04-07 | | Last modified: | 2025-03-26 | | Method: | X-RAY DIFFRACTION (1.5 Å) | | Cite: | Structural and biochemical characterization of yeast monothiol glutaredoxin Grx6
J.Mol.Biol., 398, 2010
|
|
3L9E
 | | Crystal structures of holo and Cu-deficient Cu/ZnSOD from the silkworm Bombyx mori and the implications in Amyotrophic lateral sclerosis | | Descriptor: | Superoxide dismutase [Cu-Zn], ZINC ION | | Authors: | Zhang, N.-N, He, Y.-X, Li, W.-F, Zhao, F, Yan, L.-F, Zhang, G.-Z, Teng, Y.-B, Yu, J, Chen, Y, Zhou, C.-Z. | | Deposit date: | 2010-01-05 | | Release date: | 2010-03-31 | | Last modified: | 2024-10-16 | | Method: | X-RAY DIFFRACTION (2.05 Å) | | Cite: | Crystal structures of holo and Cu-deficient Cu/Zn-SOD from the silkworm Bombyx mori and the implications in amyotrophic lateral sclerosis
Proteins, 78, 2010
|
|
3L9Y
 | | Crystal structures of holo and Cu-deficient Cu/ZnSOD from the silkworm Bombyx mori and the implications in Amyotrophic lateral sclerosis | | Descriptor: | COPPER (II) ION, Superoxide dismutase [Cu-Zn], ZINC ION | | Authors: | Zhang, N.-N, He, Y.-X, Li, W.-F, Zhao, F, Yan, L.-F, Zhang, G.-Z, Teng, Y.-B, Yu, J, Chen, Y, Zhou, C.-Z. | | Deposit date: | 2010-01-06 | | Release date: | 2010-03-23 | | Last modified: | 2024-11-13 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Crystal structures of holo and Cu-deficient Cu/Zn-SOD from the silkworm Bombyx mori and the implications in amyotrophic lateral sclerosis.
Proteins, 78, 2010
|
|
1ROQ
 | |
6LZH
 | | Crystal structure of Alpha/beta hydrolase GrgF from Penicillium sp. sh18 | | Descriptor: | GrgF, SODIUM ION | | Authors: | Wang, H, Yu, J, Wang, W.G, Matsuda, Y, Yao, M. | | Deposit date: | 2020-02-19 | | Release date: | 2020-06-24 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | Molecular Basis for the Biosynthesis of an Unusual Chain-Fused Polyketide, Gregatin A.
J.Am.Chem.Soc., 142, 2020
|
|
1R7Z
 | | NMR STRUCTURE OF THE R(GGAGGACAUUCCUCACGGGUGACCGUGGUCCUCC), DOMAIN IV STEM-LOOP B OF ENTEROVIRAL IRES WITH AUUCCU BULGE | | Descriptor: | 34-MER | | Authors: | Du, Z, Ulyanov, N.B, Yu, J, James, T.L. | | Deposit date: | 2003-10-22 | | Release date: | 2004-05-25 | | Last modified: | 2024-05-22 | | Method: | SOLUTION NMR | | Cite: | NMR Structures of Loop B RNAs from the Stem-Loop IV Domain of the Enterovirus Internal Ribosome Entry Site: A Single C to U Substitution Drastically Changes the Shape and Flexibility of RNA(,).
Biochemistry, 43, 2004
|
|
