2NWG
 
 | | Structure of CXCL12:heparin disaccharide complex | | Descriptor: | 4-deoxy-2-O-sulfo-alpha-L-threo-hex-4-enopyranuronic acid-(1-4)-2-deoxy-6-O-sulfo-2-(sulfoamino)-alpha-D-glucopyranose, Stromal cell-derived factor 1 | | Authors: | Murphy, J.W, Cho, Y, Lolis, E. | | Deposit date: | 2006-11-14 | | Release date: | 2007-02-13 | | Last modified: | 2024-10-30 | | Method: | X-RAY DIFFRACTION (2.07 Å) | | Cite: | Structural and Functional Basis of CXCL12 (Stromal Cell-derived Factor-1{alpha}) Binding to Heparin
J.Biol.Chem., 282, 2007
|
|
7CUM
 | | Cryo-EM structure of human GABA(B) receptor bound to the antagonist CGP54626 | | Descriptor: | (R)-(cyclohexylmethyl)[(2S)-3-{[(1S)-1-(3,4-dichlorophenyl)ethyl]amino}-2-hydroxypropyl]phosphinic acid, CHOLESTEROL, Gamma-aminobutyric acid type B receptor subunit 1, ... | | Authors: | Kim, Y, Jeong, E, Jeong, J, Kim, Y, Cho, Y. | | Deposit date: | 2020-08-23 | | Release date: | 2020-11-11 | | Last modified: | 2024-10-23 | | Method: | ELECTRON MICROSCOPY (3.52 Å) | | Cite: | Structural Basis for Activation of the Heterodimeric GABA B Receptor.
J.Mol.Biol., 432, 2020
|
|
7CA5
 | | Cryo-EM structure of human GABA(B) receptor in apo state | | Descriptor: | Gamma-aminobutyric acid type B receptor subunit 1, Gamma-aminobutyric acid type B receptor subunit 2 | | Authors: | Kim, Y, Jeong, E, Jeong, J, Kim, Y, Cho, Y. | | Deposit date: | 2020-06-08 | | Release date: | 2020-11-11 | | Last modified: | 2024-03-27 | | Method: | ELECTRON MICROSCOPY (7.6 Å) | | Cite: | Structural Basis for Activation of the Heterodimeric GABA B Receptor.
J.Mol.Biol., 432, 2020
|
|
1M2N
 | |
2KLO
 | | Structure of the Cdt1 C-terminal domain | | Descriptor: | DNA replication factor Cdt1 | | Authors: | Khayrutdinov, B.I, Bae, W.J, Yun, Y.M, Tsuyama, T, Kim, J.J, Hwang, E, Ryu, K.-S, Cheong, H.-K, Cheong, C, Karplus, P.A, Guntert, P, Tada, S, Jeon, Y.H, Cho, Y. | | Deposit date: | 2009-07-06 | | Release date: | 2009-10-13 | | Last modified: | 2024-05-29 | | Method: | SOLUTION NMR | | Cite: | Structure of the Cdt1 C-terminal domain: Conservation of the winged helix fold in replication licensing factors
Protein Sci., 18, 2009
|
|
1M2G
 | | Sir2 homologue-ADP ribose complex | | Descriptor: | ADENOSINE-5-DIPHOSPHORIBOSE, Silent Information Regulator 2, ZINC ION | | Authors: | Chang, J, Cho, Y. | | Deposit date: | 2002-06-24 | | Release date: | 2003-04-08 | | Last modified: | 2024-03-13 | | Method: | X-RAY DIFFRACTION (1.7 Å) | | Cite: | Structural basis for the NAD-dependent deacetylase mechanism of Sir2
J.BIOL.CHEM., 277, 2002
|
|
1M2J
 | | Sir2 homologue H80N mutant-ADP ribose complex | | Descriptor: | ADENOSINE-5-DIPHOSPHORIBOSE, Silent Information Regulator 2, ZINC ION | | Authors: | Chang, J, Cho, Y. | | Deposit date: | 2002-06-24 | | Release date: | 2003-04-08 | | Last modified: | 2024-05-29 | | Method: | X-RAY DIFFRACTION (1.7 Å) | | Cite: | Structural basis for the NAD-dependent deacetylase mechanism of Sir2
J.BIOL.CHEM., 277, 2002
|
|
1M2H
 | | Sir2 homologue S24A mutant-ADP ribose complex | | Descriptor: | ADENOSINE-5-DIPHOSPHORIBOSE, Silent Information Regulator 2, ZINC ION | | Authors: | Chang, J, Cho, Y. | | Deposit date: | 2002-06-24 | | Release date: | 2003-04-08 | | Last modified: | 2024-05-29 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Structural basis for the NAD-dependent deacetylase mechanism of Sir2
J.BIOL.CHEM., 277, 2002
|
|
5GOX
 | | Eukaryotic Rad50 Functions as A Rod-shaped Dimer | | Descriptor: | DNA repair protein RAD50, GLYCEROL, ZINC ION | | Authors: | Park, Y.B, Hohl, M, Padjasek, M, Jeong, E, Jin, K.S, Krezel, A, Petrini, J.H.J, Cho, Y. | | Deposit date: | 2016-07-30 | | Release date: | 2017-02-01 | | Last modified: | 2017-03-15 | | Method: | X-RAY DIFFRACTION (2.405 Å) | | Cite: | Eukaryotic Rad50 functions as a rod-shaped dimer
Nat. Struct. Mol. Biol., 24, 2017
|
|
1GH6
 | | RETINOBLASTOMA POCKET COMPLEXED WITH SV40 LARGE T ANTIGEN | | Descriptor: | Large T antigen, Retinoblastoma-associated protein | | Authors: | Kim, H.Y, Cho, Y. | | Deposit date: | 2000-11-15 | | Release date: | 2001-11-15 | | Last modified: | 2023-08-09 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | Structural basis for the inactivation of retinoblastoma tumor suppressor by SV40 large T antigen.
EMBO J., 20, 2001
|
|
8K6X
 | | Crystal structure of E.coli Cyanase complex with cyanate and bicarbonate | | Descriptor: | CARBONATE ION, Cyanate hydratase, SULFATE ION, ... | | Authors: | Kim, J, Nam, K.H, Cho, Y. | | Deposit date: | 2023-07-25 | | Release date: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | Structural mechanism of Escherichia coli cyanase.
Acta Crystallogr D Struct Biol, 79, 2023
|
|
8K6U
 | |
8K6G
 | | Crystal structure of E.coli Cyanase | | Descriptor: | Cyanate hydratase, SULFATE ION | | Authors: | Kim, J, Nam, K.H, Cho, Y. | | Deposit date: | 2023-07-25 | | Release date: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (1.5 Å) | | Cite: | Structural mechanism of Escherichia coli cyanase.
Acta Crystallogr D Struct Biol, 79, 2023
|
|
8K6H
 | |
8K6S
 | |
3TAL
 | | Crystal structure of NurA with manganese | | Descriptor: | DNA double-strand break repair protein nurA, GLYCEROL, MANGANESE (II) ION | | Authors: | Chae, J, Kim, Y.C, Cho, Y. | | Deposit date: | 2011-08-04 | | Release date: | 2011-11-23 | | Last modified: | 2024-10-30 | | Method: | X-RAY DIFFRACTION (3.15 Å) | | Cite: | Crystal structure of the NurA-dAMP-Mn2+ complex
Nucleic Acids Res., 40, 2012
|
|
3TAZ
 | | Crystal structure of NurA bound to dAMP and manganese | | Descriptor: | 2'-DEOXYADENOSINE-5'-MONOPHOSPHATE, DNA double-strand break repair protein nurA, GLYCEROL, ... | | Authors: | Chae, J, Kim, Y.C, Cho, Y. | | Deposit date: | 2011-08-04 | | Release date: | 2011-11-23 | | Last modified: | 2024-06-05 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | Crystal structure of the NurA-dAMP-Mn2+ complex
Nucleic Acids Res., 40, 2012
|
|
3TAI
 | | Crystal structure of NurA | | Descriptor: | DNA double-strand break repair protein nurA, GLYCEROL | | Authors: | Chae, J, Kim, Y.C, Cho, Y. | | Deposit date: | 2011-08-04 | | Release date: | 2011-11-23 | | Last modified: | 2013-07-03 | | Method: | X-RAY DIFFRACTION (2.82 Å) | | Cite: | Crystal structure of the NurA-dAMP-Mn2+ complex
Nucleic Acids Res., 40, 2012
|
|
4P0P
 | | Crystal structure of Human Mus81-Eme1 in complex with 5'-flap DNA, and Mg2+ | | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCTCAATC, ... | | Authors: | Gwon, G.H, Baek, K, Cho, Y. | | Deposit date: | 2014-02-22 | | Release date: | 2014-05-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates.
Embo J., 33, 2014
|
|
4P0Q
 | | Crystal structure of Human Mus81-Eme1 in complex with 5'-flap DNA | | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCTCAATC, ... | | Authors: | Gwon, G.H, Baek, K, Cho, Y. | | Deposit date: | 2014-02-22 | | Release date: | 2014-05-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.851 Å) | | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates.
Embo J., 33, 2014
|
|
4P0S
 | | human Mus81-Eme1-3'flap DNA complex | | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA GAATGTGTGTCT, ... | | Authors: | Gwon, G.H, Baek, K, Cho, Y. | | Deposit date: | 2014-02-22 | | Release date: | 2014-05-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (6 Å) | | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates.
Embo J., 33, 2014
|
|
4P0R
 | | human Mus81-Eme1-3'flap DNA complex | | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81, DNA ACGTGCTTACACACAGAGGTTAGGGTGAACTT, ... | | Authors: | Gwon, G.H, Baek, K, Cho, Y. | | Deposit date: | 2014-02-22 | | Release date: | 2014-05-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (6.501 Å) | | Cite: | Crystal structures of the structure-selective nuclease Mus81-Eme1 bound to flap DNA substrates.
Embo J., 33, 2014
|
|
2ZIW
 | | Crystal structure of the Mus81-Eme1 complex | | Descriptor: | Crossover junction endonuclease EME1, Mus81 protein | | Authors: | Chang, J.H, Kim, J.J, Choi, J.M, Lee, J.H, Cho, Y. | | Deposit date: | 2008-02-25 | | Release date: | 2008-04-29 | | Last modified: | 2024-10-30 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Crystal structure of the Mus81-Eme1 complex
Genes Dev., 22, 2008
|
|
2ZIV
 | | Crystal structure of the Mus81-Eme1 complex | | Descriptor: | Crossover junction endonuclease EME1, Mus81 protein | | Authors: | Chang, J.H, Kim, J.J, Choi, J.M, Lee, J.H, Cho, Y. | | Deposit date: | 2008-02-25 | | Release date: | 2008-04-29 | | Last modified: | 2024-03-13 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Crystal structure of the Mus81-Eme1 complex
Genes Dev., 22, 2008
|
|
2ZIX
 | | Crystal structure of the Mus81-Eme1 complex | | Descriptor: | Crossover junction endonuclease EME1, Crossover junction endonuclease MUS81 | | Authors: | Chang, J.H, Kim, J.J, Choi, J.M, Lee, J.H, Cho, Y. | | Deposit date: | 2008-02-25 | | Release date: | 2008-04-29 | | Last modified: | 2023-11-01 | | Method: | X-RAY DIFFRACTION (3.5 Å) | | Cite: | Crystal structure of the Mus81-Eme1 complex
Genes Dev., 22, 2008
|
|
