Author results

3M61
  • Download 3m61
  • View 3m61
Molmil generated image of 3m61
CRYSTAL STRUCTURE OF COMPLEX OF UROKINASE AND A UPAIN-1 VARIANT(W3A) IN PH4.6 CONDITION
Descriptor:Urokinase-type plasminogen activator, upain-1 W3A
Authors:Jiang, L., Yuan, C., Wind, T., Andreasen, P.A., Chen, L., Meehan, E.J., Huang, M.
Deposit date:2010-03-15
Release date:2010-04-07
Last modified:2011-07-13
Method:X-RAY DIFFRACTION (1.68 Å)
Cite:Crystal structure of complex of urokinase and a upain-1 variant(W3A) in pH4.6 condition
TO BE PUBLISHED
5Y2I
  • Download 5y2i
  • View 5y2i
Molmil generated image of 5y2i
PHOSPHOGLYCERATE MUTASE 1 (PGAM1) COMPLEXED WITH ITS INHIBITOR PGMI-004A
Descriptor:Phosphoglycerate mutase 1, 3,4-bis(oxidanyl)-9,10-bis(oxidanylidene)-~{N}-[4-(trifluoromethyl)phenyl]anthracene-2-sulfonamide, CHLORIDE ION, ...
Authors:Jiang, L., Zhou, L.
Deposit date:2017-07-26
Release date:2018-08-08
Method:X-RAY DIFFRACTION (1.917 Å)
Cite:Phosphoglycerate mutase 1 (PGAM1) complexed with its inhibitor PGMI-004A
To Be Published
1NEM
  • Download 1nem
  • View 1nem
Molmil generated image of 1nem
SACCHARIDE-RNA RECOGNITION IN THE NEOMYCIN B / RNA APTAMER COMPLEX
Descriptor:5'-R(*GP*GP*AP*CP*UP*GP*GP*GP*CP*GP*AP*GP*AP*AP*GP*UP*UP*UP*AP*GP*UP*CP*C)-3', BETA-D-RIBOFURANOSYL, O-2,6-DIAMINO-2,6-DIDEOXY-BETA-L-IDOPYRANOSE, ...
Authors:Jiang, L., Majumdar, A., Hu, W., Jaishree, T.J., Xu, W., Patel, D.J.
Deposit date:1999-03-15
Release date:1999-08-31
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Saccharide-RNA recognition in a complex formed between neomycin B and an RNA aptamer
Structure Fold.Des., 7, 1999
1TOB
  • Download 1tob
  • View 1tob
Molmil generated image of 1tob
SACCHARIDE-RNA RECOGNITION IN AN AMINOGLYCOSIDE ANTIBIOTIC-RNA APTAMER COMPLEX, NMR, 7 STRUCTURES
Descriptor:RNA (5'-R(GGCACGAGGUUUAGCUACACUCGUGCC)-3'), 3-DEOXY-3-AMINO GLUCOSE, 2,3,6-TRIDEOXY-2,6-DIAMINO GLUCOSE, ...
Authors:Jiang, L., Suri, A.K., Fiala, R., Patel, D.J.
Deposit date:1996-12-12
Release date:1997-06-16
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Saccharide-RNA recognition in an aminoglycoside antibiotic-RNA aptamer complex.
Chem.Biol., 4, 1997
2TOB
  • Download 2tob
  • View 2tob
Molmil generated image of 2tob
SOLUTION STRUCTURE OF THE TOBRAMYCIN-RNA APTAMER COMPLEX, NMR, 13 STRUCTURES
Descriptor:RNA (5'-R(*AP*CP*UP*UP*GP*GP*UP*UP*UP*AP*GP*GP*UP*AP*AP*UP*GP*AP*GP*U)-3'), 3-DEOXY-3-AMINO GLUCOSE, 2,3,6-TRIDEOXY-2,6-DIAMINO GLUCOSE, ...
Authors:Jiang, L., Patel, D.J.
Deposit date:1998-06-17
Release date:1999-06-22
Last modified:2011-07-13
Method:SOLUTION NMR
Cite:Solution structure of the tobramycin-RNA aptamer complex.
Nat.Struct.Biol., 5, 1998
3BBU
  • Download 3bbu
  • View 3bbu
Molmil generated image of 3bbu
THE HSP15 PROTEIN FITTED INTO THE LOW RESOLUTION CRYO-EM MAP OF THE 50S.NC-TRNA.HSP15 COMPLEX
Descriptor:Heat Shock Protein 15
Authors:Jiang, L., Abrahams, J.P.
Deposit date:2007-11-11
Release date:2008-10-21
Last modified:2018-07-18
Method:ELECTRON MICROSCOPY (10 Å)
Cite:Recycling of Aborted Ribosomal 50S Subunit-Nascent Chain-tRNA Complexes by the Heat Shock Protein Hsp15.
J.Mol.Biol., 386, 2009
3BBV
  • Download 3bbv
  • View 3bbv
Molmil generated image of 3bbv
THE TRNA(PHE) FITTED INTO THE LOW RESOLUTION CRYO-EM MAP OF THE 50S.NC-TRNA.HSP15 COMPLEX
Descriptor:tRNA(Phe)
Authors:Jiang, L., Abrahams, J.P.
Deposit date:2007-11-11
Release date:2008-10-21
Last modified:2018-07-18
Method:ELECTRON MICROSCOPY (10 Å)
Cite:Recycling of Aborted Ribosomal 50S Subunit-Nascent Chain-tRNA Complexes by the Heat Shock Protein Hsp15.
J.Mol.Biol., 386, 2009
3BBX
  • Download 3bbx
  • View 3bbx
Molmil generated image of 3bbx
THE HSP15 PROTEIN FITTED INTO THE LOW RESOLUTION CRYO-EM MAP OF THE 50S.NC-TRNA.HSP15 COMPLEX
Descriptor:5S ribosomal RNA, 23S ribosomal RNA, 50S ribosomal protein L25, ...
Authors:Jiang, L., Abrahams, J.P.
Deposit date:2007-11-11
Release date:2008-10-21
Last modified:2018-07-18
Method:ELECTRON MICROSCOPY (10 Å)
Cite:Recycling of Aborted Ribosomal 50S Subunit-Nascent Chain-tRNA Complexes by the Heat Shock Protein Hsp15.
J.Mol.Biol., 386, 2009
4DVA
  • Download 4dva
  • View 4dva
Molmil generated image of 4dva
THE CRYSTAL STRUCTURE OF HUMAN UROKINASE-TYPE PLASMINOGEN ACTIVATOR CATALYTIC DOMAIN
Descriptor:Urokinase-type plasminogen activator, SULFATE ION, HEXAETHYLENE GLYCOL
Authors:Jiang, L., Botkjaer, K.A., Andersen, L.M., Yuan, C., Andreasen, P.A., Huang, M.
Deposit date:2012-02-23
Release date:2013-01-16
Method:X-RAY DIFFRACTION (1.94 Å)
Cite:Rezymogenation of active urokinase induced by an inhibitory antibody
Biochem.J., 449, 2013
4DVB
  • Download 4dvb
  • View 4dvb
Molmil generated image of 4dvb
THE CRYSTAL STRUCTURE OF THE FAB FRAGMENT OF PRO-UPA ANTIBODY MAB-112
Descriptor:Fab fragment of pro-uPA antibody mAb-112, SULFATE ION, TETRAETHYLENE GLYCOL
Authors:Jiang, L., Botkjaer, K.A., Andersen, L.M., Yuan, C., Andreasen, P.A., Huang, M.
Deposit date:2012-02-23
Release date:2013-01-16
Method:X-RAY DIFFRACTION (1.93 Å)
Cite:Rezymogenation of active urokinase induced by an inhibitory antibody.
Biochem.J., 449, 2013
4DW2
  • Download 4dw2
  • View 4dw2
Molmil generated image of 4dw2
THE CRYSTAL STRUCTURE OF UPA IN COMPLEX WITH THE FAB FRAGMENT OF MAB-112
Descriptor:Urokinase-type plasminogen activator, Fab fragment of pro-uPA antibody mAb-112, SULFATE ION
Authors:Jiang, L., Botkjaer, K.A., Andersen, L.M., Yuan, C., Andreasen, P.A., Huang, M.
Deposit date:2012-02-24
Release date:2013-01-16
Method:X-RAY DIFFRACTION (2.97 Å)
Cite:Rezymogenation of active urokinase induced by an inhibitory antibody.
Biochem.J., 449, 2013
4IYP
  • Download 4iyp
  • View 4iyp
Molmil generated image of 4iyp
STRUCTURE OF THE NPP2AC-ALPHA4 COMPLEX
Descriptor:Immunoglobulin-binding protein 1, Serine/threonine-protein phosphatase 2A catalytic subunit alpha isoform
Authors:Jiang, L., Stanevich, V., Satyshur, K.A., Xing, Y.
Deposit date:2013-01-29
Release date:2013-04-17
Last modified:2017-11-15
Method:X-RAY DIFFRACTION (2.797 Å)
Cite:Structural basis of protein phosphatase 2A stable latency.
Nat Commun, 4, 2013
4NK4
  • Download 4nk4
  • View 4nk4
Molmil generated image of 4nk4
CRYSTAL STRUCTURE OF FABI FROM CANDIDATUS LIBERIBACTER ASIATICUS
Descriptor:Enoyl-[acyl-carrier-protein] reductase [NADH], DI(HYDROXYETHYL)ETHER
Authors:Jiang, L., Gao, Z.Q., Dong, Y.H.
Deposit date:2013-11-12
Release date:2014-02-12
Last modified:2017-11-22
Method:X-RAY DIFFRACTION (1.7 Å)
Cite:Crystal structures and kinetic properties of enoyl-acyl carrier protein reductase I from Candidatus Liberibacter asiaticus.
Protein Sci., 23, 2014
4NK5
  • Download 4nk5
  • View 4nk5
Molmil generated image of 4nk5
CRYSTAL STRUCTURE OF FABI-NAD COMPLEX FROM CANDIDATUS LIBERIBACTER ASIATICUS
Descriptor:Enoyl-[acyl-carrier-protein] reductase [NADH], NICOTINAMIDE-ADENINE-DINUCLEOTIDE
Authors:Jiang, L., Gao, Z.Q., Dong, Y.H.
Deposit date:2013-11-12
Release date:2014-02-12
Last modified:2014-04-09
Method:X-RAY DIFFRACTION (2.7 Å)
Cite:Crystal structures and kinetic properties of enoyl-acyl carrier protein reductase I from Candidatus Liberibacter asiaticus.
Protein Sci., 23, 2014
4X0W
  • Download 4x0w
  • View 4x0w
Molmil generated image of 4x0w
THE CRYSTAL STRUCTURE OF MUPAIN-1-17 IN COMPLEX WITH MURINISED HUMAN UPA
Descriptor:mupain-1-17, Urokinase-type plasminogen activator, piperidine-1-carboximidamide, ...
Authors:Jiang, L., Zhao, B., Xu, P., Andreasen, P., Huang, M.
Deposit date:2014-11-24
Release date:2015-10-21
Last modified:2017-10-18
Method:X-RAY DIFFRACTION (2.1 Å)
Cite:Distinctive binding modes and inhibitory mechanisms of two peptidic inhibitors of urokinase-type plasminogen activator with isomeric P1 residues.
Int.J.Biochem.Cell Biol., 62, 2015
4X1P
  • Download 4x1p
  • View 4x1p
Molmil generated image of 4x1p
THE CRYSTAL STRUCTURE OF MUPAIN-1-17 IN COMPLEX WITH MURINISED HUMAN UPA AT PH4.6
Descriptor:Urokinase-type plasminogen activator, MUPAIN-1-17, SULFATE ION, ...
Authors:Jiang, L., Zhao, B., Xu, P., Andreasen, P., Huang, M.
Deposit date:2014-11-25
Release date:2015-10-21
Last modified:2017-10-18
Method:X-RAY DIFFRACTION (1.6 Å)
Cite:Distinctive binding modes and inhibitory mechanisms of two peptidic inhibitors of urokinase-type plasminogen activator with isomeric P1 residues.
Int.J.Biochem.Cell Biol., 62, 2015
4ZKN
  • Download 4zkn
  • View 4zkn
Molmil generated image of 4zkn
THE CRYSTAL STRUCTURE OF UPAIN-1-W3A IN COMPLEX WITH UPA AT PH5.5
Descriptor:Urokinase-type plasminogen activator, upain-1-W3A, SULFATE ION, ...
Authors:Jiang, L., Andreasen, P.A., Huang, M.
Deposit date:2015-04-30
Release date:2016-05-18
Method:X-RAY DIFFRACTION (1.36 Å)
Cite:The crystal structure of mupain-1-IG in complex with murinised human uPA at pH7.4
To Be Published
4ZKO
  • Download 4zko
  • View 4zko
Molmil generated image of 4zko
THE CRYSTAL STRUCTURE OF UPAIN-1-W3A IN COMPLEX WITH UPA AT PH7.4
Descriptor:Urokinase-type plasminogen activator, N-terminal fragment of upain-1-W3A, C-terminal fragment of upain-1-W3A, ...
Authors:Jiang, L., Andreasen, P.A., Huang, M.
Deposit date:2015-04-30
Release date:2016-05-18
Method:X-RAY DIFFRACTION (1.29 Å)
Cite:The crystal structure of mupain-1-IG in complex with murinised human uPA at pH7.4
To Be Published
4ZKR
  • Download 4zkr
  • View 4zkr
Molmil generated image of 4zkr
THE CRYSTAL STRUCTURE OF UPAIN-1-W3A IN COMPLEX WITH UPA AT PH9.0
Descriptor:Urokinase-type plasminogen activator, upain-1-W3A, SULFATE ION, ...
Authors:Jiang, L., Andreasen, P.A., Huang, M.
Deposit date:2015-04-30
Release date:2016-05-18
Method:X-RAY DIFFRACTION (1.36 Å)
Cite:The crystal structure of mupain-1-IG in complex with murinised human uPA at pH7.4
To Be Published
4ZKS
  • Download 4zks
  • View 4zks
Molmil generated image of 4zks
THE CRYSTAL STRUCTURE OF UPAIN-1-W3A IN COMPLEX WITH INACTIVE UPA (UPA-S195A) AT PH7.4
Descriptor:Urokinase-type plasminogen activator, upain-1-W3A
Authors:Jiang, L., Andreasen, P.A., Huang, M.
Deposit date:2015-04-30
Release date:2016-05-18
Method:X-RAY DIFFRACTION (1.85 Å)
Cite:The crystal structure of mupain-1-IG in complex with murinised human uPA at pH7.4
To Be Published
5D0N
  • Download 5d0n
  • View 5d0n
Molmil generated image of 5d0n
CRYSTAL STRUCTURE OF MAIZE PDRP BOUND WITH AMP
Descriptor:Pyruvate, phosphate dikinase regulatory protein, chloroplastic, ...
Authors:Jiang, L., Chen, Z.
Deposit date:2015-08-03
Release date:2016-02-24
Last modified:2016-03-09
Method:X-RAY DIFFRACTION (3.2 Å)
Cite:Structural Basis of Reversible Phosphorylation by Maize Pyruvate Orthophosphate Dikinase Regulatory Protein
Plant Physiol., 170, 2016
5D1F
  • Download 5d1f
  • View 5d1f
Molmil generated image of 5d1f
CRYSTAL STRUCTURE OF MAIZE PDRP BOUND WITH AMP AND HG2+
Descriptor:Pyruvate, phosphate dikinase regulatory protein, chloroplastic, ...
Authors:Jiang, L., Chen, Z.
Deposit date:2015-08-04
Release date:2016-02-24
Method:X-RAY DIFFRACTION (3.4 Å)
Cite:Structural Basis of Reversible Phosphorylation by Maize Pyruvate Orthophosphate Dikinase Regulatory Protein
Plant Physiol., 170, 2016
5WXF
  • Download 5wxf
  • View 5wxf
Molmil generated image of 5wxf
CRYSTAL STRUCTURE OF UPA IN COMPLEX WITH UPAIN-2-2
Descriptor:Urokinase-type plasminogen activator chain B, upain-2-2 peptide, SULFATE ION
Authors:Jiang, L., Huang, M.
Deposit date:2017-01-07
Release date:2018-07-11
Last modified:2018-07-18
Method:X-RAY DIFFRACTION (1.46 Å)
Cite:Cleavage of peptidic inhibitors by target protease is caused by peptide conformational transition.
Biochim. Biophys. Acta, 1862, 2018
5WXO
  • Download 5wxo
  • View 5wxo
Molmil generated image of 5wxo
CRYSTAL STRUCTURE OF UPA IN COMPLEX WITH UPAIN-2-2-W3A
Descriptor:Urokinase-type plasminogen activator chain B, upain-2-2-W3A peptide
Authors:Jiang, L., Huang, M.
Deposit date:2017-01-08
Release date:2018-07-11
Last modified:2018-07-18
Method:X-RAY DIFFRACTION (1.64 Å)
Cite:Cleavage of peptidic inhibitors by target protease is caused by peptide conformational transition.
Biochim. Biophys. Acta, 1862, 2018
5WXP
  • Download 5wxp
  • View 5wxp
Molmil generated image of 5wxp
CRYSTAL STRUCTURE OF UPA IN COMPLEX WITH UPAIN-2-3-W3A
Descriptor:Urokinase-type plasminogen activator chain B, upain-2-3-W3A peptide, ALANINE, ...
Authors:Jiang, L., Huang, M.
Deposit date:2017-01-08
Release date:2018-07-11
Last modified:2018-07-18
Method:X-RAY DIFFRACTION (1.75 Å)
Cite:Cleavage of peptidic inhibitors by target protease is caused by peptide conformational transition.
Biochim. Biophys. Acta, 1862, 2018