1A1D
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1a1d by Molmil](/molmil-images/mine/1a1d) | YEAST RNA POLYMERASE SUBUNIT RPB8, NMR, MINIMIZED AVERAGE STRUCTURE, ALPHA CARBONS ONLY | Descriptor: | RNA POLYMERASE | Authors: | Krapp, S, Kelly, G, Reischl, J, Weinzierl, R, Matthews, S. | Deposit date: | 1997-12-10 | Release date: | 1999-03-02 | Last modified: | 2024-04-10 | Method: | SOLUTION NMR | Cite: | Eukaryotic RNA polymerase subunit RPB8 is a new relative of the OB family. Nat.Struct.Biol., 5, 1998
|
|
4PEH
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4peh by Molmil](/molmil-images/mine/4peh) | Dbr1 in complex with synthetic linear RNA | Descriptor: | GLYCEROL, MANGANESE (II) ION, RNA (5'-R(*CP*UP*AP*(A2P)P*AP*CP*AP*A)-3'), ... | Authors: | Montemayor, E.J, Katolik, A, Clark, N.E, Taylor, A.B, Schuermann, J.P, Combs, D.J, Johnsson, R, Holloway, S.P, Stevens, S.W, Damha, M.J, Hart, P.J. | Deposit date: | 2014-04-23 | Release date: | 2014-08-27 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (2.1 Å) | Cite: | Structural basis of lariat RNA recognition by the intron debranching enzyme Dbr1. Nucleic Acids Res., 42, 2014
|
|
7TQB
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7tqb by Molmil](/molmil-images/mine/7tqb) | |
6NTY
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6nty by Molmil](/molmil-images/mine/6nty) | 2.1 A resolution structure of the Musashi-2 (Msi2) RNA recognition motif 1 (RRM1) domain | Descriptor: | PHOSPHATE ION, RNA-binding protein Musashi homolog 2 | Authors: | Lovell, S, Kashipathy, M.M, Battaile, K.P, Lan, L, Xiaoqing, W, Cooper, A, Gao, F.P, Xu, L. | Deposit date: | 2019-01-30 | Release date: | 2019-10-23 | Last modified: | 2023-10-11 | Method: | X-RAY DIFFRACTION (2.1 Å) | Cite: | Crystal and solution structures of human oncoprotein Musashi-2 N-terminal RNA recognition motif 1. Proteins, 88, 2020
|
|
6ZLC
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6zlc by Molmil](/molmil-images/mine/6zlc) | Non-specific dsRNA recognition by wildtype H7N1 RNA-binding domain | Descriptor: | NITRATE ION, Non-structural protein 1, RNA (5'-R(*AP*GP*AP*CP*AP*GP*CP*AP*UP*UP*AP*UP*GP*CP*UP*GP*UP*CP*U)-3'), ... | Authors: | Coste, F, Wacquiez, A, Marc, D, Castaing, B. | Deposit date: | 2020-06-30 | Release date: | 2020-10-07 | Last modified: | 2024-01-31 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | Structure and Sequence Determinants Governing the Interactions of RNAs with Influenza A Virus Non-Structural Protein NS1. Viruses, 12, 2020
|
|
6O0X
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6o0x by Molmil](/molmil-images/mine/6o0x) | Conformational states of Cas9-sgRNA-DNA ternary complex in the presence of magnesium | Descriptor: | 3' product of target strand DNA, 5' product of target strand DNA, CRISPR-associated endonuclease Cas9/Csn1, ... | Authors: | Zhu, X, Clarke, R, Puppala, A.K, Chittori, S, Merk, A, Merrill, B.J, Simonovic, M, Subramaniam, S. | Deposit date: | 2019-02-17 | Release date: | 2019-07-10 | Last modified: | 2024-03-20 | Method: | ELECTRON MICROSCOPY (3.28 Å) | Cite: | Cryo-EM structures reveal coordinated domain motions that govern DNA cleavage by Cas9. Nat.Struct.Mol.Biol., 26, 2019
|
|
5B43
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5b43 by Molmil](/molmil-images/mine/5b43) | Crystal structure of Acidaminococcus sp. Cpf1 in complex with crRNA and target DNA | Descriptor: | 1,2-ETHANEDIOL, CRISPR-associated endonuclease Cpf1, DNA (34-MER), ... | Authors: | Yamano, T, Nishimasu, H, Hirano, H, Nakane, T, Ishitani, R, Nureki, O. | Deposit date: | 2016-03-30 | Release date: | 2016-05-04 | Last modified: | 2024-03-20 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | Crystal Structure of Cpf1 in Complex with Guide RNA and Target DNA Cell, 165, 2016
|
|
7U0Y
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7u0y by Molmil](/molmil-images/mine/7u0y) | |
6O0Z
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6o0z by Molmil](/molmil-images/mine/6o0z) | Conformational states of Cas9-sgRNA-DNA ternary complex in the presence of magnesium | Descriptor: | CRISPR-associated endonuclease Cas9/Csn1, non-target strand DNA, single guide RNA, ... | Authors: | Zhu, X, Clarke, R, Puppala, A.K, Chittori, S, Merk, A, Merrill, B.J, Simonovic, M, Subramaniam, S. | Deposit date: | 2019-02-17 | Release date: | 2019-07-10 | Last modified: | 2024-03-20 | Method: | ELECTRON MICROSCOPY (3.3 Å) | Cite: | Cryo-EM structures reveal coordinated domain motions that govern DNA cleavage by Cas9. Nat.Struct.Mol.Biol., 26, 2019
|
|
1HVU
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1hvu by Molmil](/molmil-images/mine/1hvu) | |
7MKJ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7mkj by Molmil](/molmil-images/mine/7mkj) | Cryo-EM structure of Escherichia coli RNA polymerase bound to T7A1 promoter DNA | Descriptor: | CHAPSO, DNA-directed RNA polymerase subunit alpha, DNA-directed RNA polymerase subunit beta, ... | Authors: | Saecker, R.M, Darst, S.A, Chen, J. | Deposit date: | 2021-04-23 | Release date: | 2021-09-29 | Last modified: | 2024-05-29 | Method: | ELECTRON MICROSCOPY (2.9 Å) | Cite: | Structural origins of Escherichia coli RNA polymerase open promoter complex stability. Proc.Natl.Acad.Sci.USA, 118, 2021
|
|
7MKD
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7mkd by Molmil](/molmil-images/mine/7mkd) | Cryo-EM structure of Escherichia coli RNA polymerase bound to lambda PR promoter DNA (class 1) | Descriptor: | CHAPSO, DNA-directed RNA polymerase subunit alpha, DNA-directed RNA polymerase subunit beta, ... | Authors: | Saecker, R.M, Darst, S.A, Chen, J. | Deposit date: | 2021-04-23 | Release date: | 2021-09-29 | Last modified: | 2021-10-13 | Method: | ELECTRON MICROSCOPY (3.2 Å) | Cite: | Structural origins of Escherichia coli RNA polymerase open promoter complex stability. Proc.Natl.Acad.Sci.USA, 118, 2021
|
|
7MKE
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7mke by Molmil](/molmil-images/mine/7mke) | Cryo-EM structure of Escherichia coli RNA polymerase bound to lambda PR promoter DNA (class 2) | Descriptor: | CHAPSO, DNA-directed RNA polymerase subunit alpha, DNA-directed RNA polymerase subunit beta, ... | Authors: | Saecker, R.M, Darst, S.A, Chen, J. | Deposit date: | 2021-04-23 | Release date: | 2021-09-29 | Last modified: | 2021-10-13 | Method: | ELECTRON MICROSCOPY (3.7 Å) | Cite: | Structural origins of Escherichia coli RNA polymerase open promoter complex stability. Proc.Natl.Acad.Sci.USA, 118, 2021
|
|
7MKT
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7mkt by Molmil](/molmil-images/mine/7mkt) | Crystal structure of r(GU)11G-NMM complex | Descriptor: | N-METHYLMESOPORPHYRIN, POTASSIUM ION, RNA (5'-R(*GP*UP*GP*UP*GP*UP*GP*UP*GP*UP*GP*UP*GP*UP*GP*UP*GP*UP*GP*UP*GP*UP*G)-3') | Authors: | Bingman, C.A, Roschdi, S, Nomura, Y, Butcher, S.E. | Deposit date: | 2021-04-26 | Release date: | 2022-11-02 | Last modified: | 2024-05-22 | Method: | X-RAY DIFFRACTION (1.97 Å) | Cite: | An atypical RNA quadruplex marks RNAs as vectors for gene silencing. Nat.Struct.Mol.Biol., 29, 2022
|
|
3QQC
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3qqc by Molmil](/molmil-images/mine/3qqc) | Crystal structure of archaeal Spt4/5 bound to the RNAP clamp domain | Descriptor: | DNA-directed RNA polymerase subunit b, DNA-directed RNA polymerase subunit a', DNA-directed RNA polymerase subunit A'', ... | Authors: | Martinez-Rucobo, F.W. | Deposit date: | 2011-02-15 | Release date: | 2011-03-23 | Last modified: | 2023-09-13 | Method: | X-RAY DIFFRACTION (3.3 Å) | Cite: | Architecture of the RNA polymerase-Spt4/5 complex and basis of universal transcription processivity. Embo J., 30, 2011
|
|
6PIJ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6pij by Molmil](/molmil-images/mine/6pij) | Target DNA-bound V. cholerae TniQ-Cascade complex, closed conformation | Descriptor: | Non-targeting strand ssDNA, Targeting strand ssDNA, TniQ monomer 2, ... | Authors: | Halpin-Healy, T, Klompe, S, Sternberg, S.H. | Deposit date: | 2019-06-26 | Release date: | 2019-10-02 | Last modified: | 2024-03-20 | Method: | ELECTRON MICROSCOPY (2.9 Å) | Cite: | Structural basis of DNA targeting by a transposon-encoded CRISPR-Cas system. Nature, 577, 2020
|
|
6PIF
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6pif by Molmil](/molmil-images/mine/6pif) | V. cholerae TniQ-Cascade complex, open conformation | Descriptor: | Cas7, type I-F CRISPR-associated protein, TniQ monomer 1, ... | Authors: | Halpin-Healy, T, Klompe, S, Sternberg, S.H. | Deposit date: | 2019-06-26 | Release date: | 2019-10-02 | Last modified: | 2024-03-20 | Method: | ELECTRON MICROSCOPY (3.4 Å) | Cite: | Structural basis of DNA targeting by a transposon-encoded CRISPR-Cas system. Nature, 577, 2020
|
|
7OJK
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7ojk by Molmil](/molmil-images/mine/7ojk) | Lassa virus L protein bound to the distal promoter duplex [DISTAL-PROMOTER] | Descriptor: | 3' RNA, 5' RNA, RNA-directed RNA polymerase L, ... | Authors: | Kouba, T, Vogel, D, Thorkelsson, S, Quemin, E, Williams, H.M, Milewski, M, Busch, C, Gunther, S, Grunewald, K, Rosenthal, M, Cusack, S. | Deposit date: | 2021-05-16 | Release date: | 2021-12-01 | Last modified: | 2024-05-01 | Method: | ELECTRON MICROSCOPY (3.89 Å) | Cite: | Conformational changes in Lassa virus L protein associated with promoter binding and RNA synthesis activity. Nat Commun, 12, 2021
|
|
6H9I
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6h9i by Molmil](/molmil-images/mine/6h9i) | Csf5, CRISPR-Cas type IV Cas6 crRNA endonuclease | Descriptor: | Csf5, GLYCEROL, L(+)-TARTARIC ACID, ... | Authors: | Pausch, P, Bange, G. | Deposit date: | 2018-08-04 | Release date: | 2018-09-26 | Last modified: | 2024-01-17 | Method: | X-RAY DIFFRACTION (2.29 Å) | Cite: | Type IV CRISPR RNA processing and effector complex formation in Aromatoleum aromaticum. Nat Microbiol, 4, 2019
|
|
6H9H
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6h9h by Molmil](/molmil-images/mine/6h9h) | Csf5, CRISPR-Cas type IV Cas6 crRNA endonuclease | Descriptor: | Csf5, GLYCEROL, L(+)-TARTARIC ACID, ... | Authors: | Pausch, P, Bange, G. | Deposit date: | 2018-08-04 | Release date: | 2018-09-26 | Last modified: | 2024-05-15 | Method: | X-RAY DIFFRACTION (1.75 Å) | Cite: | Type IV CRISPR RNA processing and effector complex formation in Aromatoleum aromaticum. Nat Microbiol, 4, 2019
|
|
1QWB
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1qwb by Molmil](/molmil-images/mine/1qwb) | |
1QWA
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1qwa by Molmil](/molmil-images/mine/1qwa) | NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12. | Descriptor: | 18S ribosomal RNA, 5'ETS | Authors: | Finger, L.D, Trantirek, L, Johansson, C, Feigon, J. | Deposit date: | 2003-09-01 | Release date: | 2003-11-25 | Last modified: | 2024-05-01 | Method: | SOLUTION NMR | Cite: | Solution Strucutres of Stem-loop RNAs that Bind to the Two N-terminal RNA Binding Domains of Nucleolin Nucleic Acids Res., 31, 2003
|
|
6IV9
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6iv9 by Molmil](/molmil-images/mine/6iv9) | the Cas13d binary complex | Descriptor: | Cas13d, MAGNESIUM ION, crRNA (50-MER) | Authors: | Zhang, B, Ye, Y.M, Ye, W.W, OuYang, S.Y. | Deposit date: | 2018-12-02 | Release date: | 2019-06-19 | Last modified: | 2023-11-22 | Method: | X-RAY DIFFRACTION (1.86 Å) | Cite: | Two HEPN domains dictate CRISPR RNA maturation and target cleavage in Cas13d. Nat Commun, 10, 2019
|
|
6ZM2
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6zm2 by Molmil](/molmil-images/mine/6zm2) | |
4Q96
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4q96 by Molmil](/molmil-images/mine/4q96) | CID of human RPRD1B in complex with an unmodified CTD peptide | Descriptor: | RPB1-CTD, Regulation of nuclear pre-mRNA domain-containing protein 1B, SULFATE ION, ... | Authors: | Ni, Z, Xu, C, Tempel, W, El Bakkouri, M, Loppnau, P, Guo, X, Bountra, C, Arrowsmith, C.H, Edwards, A.M, Min, J, Greenblatt, J.F, Structural Genomics Consortium (SGC) | Deposit date: | 2014-04-29 | Release date: | 2014-06-04 | Last modified: | 2014-08-20 | Method: | X-RAY DIFFRACTION (1.85 Å) | Cite: | RPRD1A and RPRD1B are human RNA polymerase II C-terminal domain scaffolds for Ser5 dephosphorylation. Nat.Struct.Mol.Biol., 21, 2014
|
|