5B0Y
 
 | | Crystal structure of the nucleosome containing histone H3 with the crotonylated lysine 122 | | Descriptor: | CHLORIDE ION, DNA (146-MER), Histone H2A type 1-B/E, ... | | Authors: | Suzuki, Y, Horikoshi, N, Kurumizaka, H. | | Deposit date: | 2015-11-13 | | Release date: | 2016-01-27 | | Last modified: | 2023-11-15 | | Method: | X-RAY DIFFRACTION (2.557 Å) | | Cite: | Crystal structure of the nucleosome containing histone H3 with crotonylated lysine 122
Biochem.Biophys.Res.Commun., 469, 2016
|
|
7XCR
 | | Cryo-EM structure of Dot1L and H2BK34ub-H3K79Nle nucleosome 1:1 complex | | Descriptor: | DNA (146-MER), Histone H2A, Histone H2B type 1-K, ... | | Authors: | Ai, H.S, Liu, A.J, Lou, Z.Y, Liu, L. | | Deposit date: | 2022-03-25 | | Release date: | 2022-04-20 | | Last modified: | 2022-09-07 | | Method: | ELECTRON MICROSCOPY (2.57 Å) | | Cite: | H2B Lys34 Ubiquitination Induces Nucleosome Distortion to Stimulate Dot1L Activity.
Nat.Chem.Biol., 18, 2022
|
|
8CZE
 | | Structure of a Xenopus Nucleosome with Widom 601 DNA | | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | | Authors: | Gu, Y, Ur, S.N, Milano, C.R, Tromer, E.C, Vale-Silva, L.A, Hochwagen, A, Corbett, K.D. | | Deposit date: | 2022-05-24 | | Release date: | 2023-06-07 | | Last modified: | 2024-04-10 | | Method: | ELECTRON MICROSCOPY (2.58 Å) | | Cite: | Chromatin binding by HORMAD proteins regulates meiotic recombination initiation.
Embo J., 43, 2024
|
|
4J8V
 | |
8T9F
 | |
4WU9
 | | Structure of cisPtNAP-NCP145 | | Descriptor: | DNA (145-MER), Histone H2A type 1, Histone H2B 1.1, ... | | Authors: | Chua, E.Y.D, Davey, G.E, Chin, C.F, Droge, P, Ang, W.H, Davey, C.A. | | Deposit date: | 2014-10-31 | | Release date: | 2015-09-02 | | Last modified: | 2024-03-20 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Stereochemical control of nucleosome targeting by platinum-intercalator antitumor agents.
Nucleic Acids Res., 43, 2015
|
|
3REK
 | |
7SWY
 | | 2.6 A structure of a 40-601[TA-rich+1]-40 nucleosome | | Descriptor: | DNA Guide Strand, DNA Tracking Strand, Histone H2A, ... | | Authors: | Nodelman, I.M, Bowman, G.D, Armache, J.-P. | | Deposit date: | 2021-11-21 | | Release date: | 2022-03-02 | | Last modified: | 2024-06-05 | | Method: | ELECTRON MICROSCOPY (2.6 Å) | | Cite: | Nucleosome recognition and DNA distortion by the Chd1 remodeler in a nucleotide-free state.
Nat.Struct.Mol.Biol., 29, 2022
|
|
1KX4
 | | X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution | | Descriptor: | CHLORIDE ION, DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3'), MANGANESE (II) ION, ... | | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | | Deposit date: | 2002-01-31 | | Release date: | 2002-12-25 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
|
|
5CP6
 | | Nucleosome Core Particle with Adducts from the Anticancer Compound, [(eta6-5,8,9,10-tetrahydroanthracene)Ru(ethylenediamine)Cl][PF6] | | Descriptor: | (ethane6-5,8,9,10-tetrahydroanthracene)Ru(II)(ethylene-diamine)Cl, DNA (145-MER), Histone H2A, ... | | Authors: | Ma, Z, Adhireksan, Z, Murray, B.S, Dyson, P.J, Davey, C.A. | | Deposit date: | 2015-07-21 | | Release date: | 2016-06-01 | | Last modified: | 2023-11-08 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | An Organometallic Compound which Exhibits a DNA Topology-Dependent One-Stranded Intercalation Mode.
Angew.Chem.Int.Ed.Engl., 55, 2016
|
|
1F66
 | | 2.6 A CRYSTAL STRUCTURE OF A NUCLEOSOME CORE PARTICLE CONTAINING THE VARIANT HISTONE H2A.Z | | Descriptor: | HISTONE H2A.Z, HISTONE H2B, HISTONE H3, ... | | Authors: | Suto, R.K, Clarkson, M.J, Tremethick, D.J, Luger, K. | | Deposit date: | 2000-06-20 | | Release date: | 2000-11-27 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Crystal structure of a nucleosome core particle containing the variant histone H2A.Z.
Nat.Struct.Biol., 7, 2000
|
|
5XF6
 | | Nucleosome core particle with an adduct of a binuclear RAPTA (Ru-arene-phosphaadamantane) compound having an ethylenediamine linker | | Descriptor: | DNA (145-MER), ETHANE-1,2-DIAMINE, Histone H2A, ... | | Authors: | Ma, Z, Adhireksan, Z, Murray, B.S, Dyson, P.J, Davey, C.A. | | Deposit date: | 2017-04-07 | | Release date: | 2017-10-11 | | Last modified: | 2023-11-22 | | Method: | X-RAY DIFFRACTION (2.63 Å) | | Cite: | Nucleosome acidic patch-targeting binuclear ruthenium compounds induce aberrant chromatin condensation
Nat Commun, 8, 2017
|
|
5F99
 | |
3MGQ
 | | Binding of Nickel ions to the Nucleosome Core Particle | | Descriptor: | CHLORIDE ION, DNA (147-MER), Histone H2A, ... | | Authors: | Mohideen, K, Muhammad, R, Davey, C.A. | | Deposit date: | 2010-04-07 | | Release date: | 2010-06-16 | | Last modified: | 2023-11-01 | | Method: | X-RAY DIFFRACTION (2.65 Å) | | Cite: | Perturbations in nucleosome structure from heavy metal association.
Nucleic Acids Res., 38, 2010
|
|
2NZD
 | | Nucleosome core particle containing 145 bp of DNA | | Descriptor: | DNA (145-MER), Histone H2B, Histone H3, ... | | Authors: | Ong, M.S, Richmond, T.J, Davey, C.A. | | Deposit date: | 2006-11-23 | | Release date: | 2007-04-10 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (2.65 Å) | | Cite: | DNA stretching and extreme kinking in the nucleosome core
J.Mol.Biol., 368, 2007
|
|
3REI
 | |
8PEO
 | | H3K36me2 nucleosome-LEDGF/p75 PWWP domain complex | | Descriptor: | (2R)-2-amino-3-(2-dimethylaminoethylsulfanyl)propanoic acid, Histone H2A, Histone H2B 1.1, ... | | Authors: | Koutna, E, Kouba, T, Veverka, V. | | Deposit date: | 2023-06-14 | | Release date: | 2023-08-16 | | Last modified: | 2023-11-15 | | Method: | ELECTRON MICROSCOPY (2.69 Å) | | Cite: | Multivalency of nucleosome recognition by LEDGF.
Nucleic Acids Res., 51, 2023
|
|
4KGC
 | | Nucleosome Core Particle Containing (ETA6-P-CYMENE)-(1, 2-ETHYLENEDIAMINE)-RUTHENIUM | | Descriptor: | (ethane-1,2-diamine-kappa~2~N,N')[(1,2,3,4,5,6-eta)-1-methyl-4-(propan-2-yl)cyclohexane-1,2,3,4,5,6-hexayl]ruthenium, DNA (145-mer), Histone H2A, ... | | Authors: | Adhireksan, Z, Davey, C.A. | | Deposit date: | 2013-04-29 | | Release date: | 2014-03-26 | | Last modified: | 2024-03-20 | | Method: | X-RAY DIFFRACTION (2.69 Å) | | Cite: | Ligand substitutions between ruthenium-cymene compounds can control protein versus DNA targeting and anticancer activity
Nat Commun, 5, 2014
|
|
1P34
 | | Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | | Authors: | Muthurajan, U.M, Bao, Y, Forsberg, L.J, Edayathumangalam, R.S, Dyer, P.N, White, C.L, Luger, K. | | Deposit date: | 2003-04-17 | | Release date: | 2004-02-24 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions
EMBO J., 23, 2004
|
|
2IO5
 | | Crystal structure of the CIA- histone H3-H4 complex | | Descriptor: | ASF1A protein, Histone H3.1, Histone H4 | | Authors: | Natsume, R, Akai, Y, Horikoshi, M, Senda, T. | | Deposit date: | 2006-10-10 | | Release date: | 2007-02-27 | | Last modified: | 2023-10-25 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Structure and function of the histone chaperone CIA/ASF1 complexed with histones H3 and H4.
Nature, 446, 2007
|
|
3REL
 | |
1P3P
 | | Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | | Authors: | Muthurajan, U.M, Bao, Y, Forsberg, L.J, Edayathumangalam, R.S, Dyer, P.N, White, C.L, Luger, K. | | Deposit date: | 2003-04-17 | | Release date: | 2004-02-24 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions
EMBO J., 23, 2004
|
|
1P3G
 | | Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | | Authors: | Muthurajan, U.M, Bao, Y, Forsberg, L.J, Edayathumangalam, R.S, Dyer, P.N, White, C.L, Luger, K. | | Deposit date: | 2003-04-17 | | Release date: | 2004-02-24 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions
EMBO J., 23, 2004
|
|
7XCT
 | | Cryo-EM structure of Dot1L and H2BK34ub-H3K79Nle nucleosome 2:1 complex | | Descriptor: | DNA (145-MER), Histone H2A, Histone H2B type 1-K, ... | | Authors: | Ai, H.S, Liu, A.J, Lou, Z.Y, Liu, L. | | Deposit date: | 2022-03-25 | | Release date: | 2022-04-20 | | Last modified: | 2022-09-07 | | Method: | ELECTRON MICROSCOPY (2.72 Å) | | Cite: | H2B Lys34 Ubiquitination Induces Nucleosome Distortion to Stimulate Dot1L Activity.
Nat.Chem.Biol., 18, 2022
|
|
8CWW
 | | Structure of S. cerevisiae Hop1 CBR bound to a nucleosome | | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | | Authors: | Gu, Y, Ur, S.N, Milano, C.R, Tromer, E.C, Vale-Silva, L.A, Hochwagen, A, Corbett, K.D. | | Deposit date: | 2022-05-19 | | Release date: | 2023-06-07 | | Last modified: | 2024-04-10 | | Method: | ELECTRON MICROSCOPY (2.74 Å) | | Cite: | Chromatin binding by HORMAD proteins regulates meiotic recombination initiation.
Embo J., 43, 2024
|
|
