6W4L
| The crystal structure of a single chain H2B-H2A histone chimera from Xenopus laevis | Descriptor: | Histone H2B 1.1,Histone H2A type 1, PYROPHOSPHATE | Authors: | Warren, C, Bonanno, J.B, Almo, S.C, Shechter, D. | Deposit date: | 2020-03-11 | Release date: | 2020-05-06 | Last modified: | 2023-10-18 | Method: | X-RAY DIFFRACTION (1.31 Å) | Cite: | Structure of a single-chain H2A/H2B dimer. Acta Crystallogr.,Sect.F, 76, 2020
|
|
1KX5
| X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution | Descriptor: | CHLORIDE ION, DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (1.94 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
1KX3
| X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution | Descriptor: | DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3'), MANGANESE (II) ION, histone H2A.1, ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
1S32
| Molecular Recognition of the Nucleosomal 'Supergroove' | Descriptor: | 2-(2-CARBAMOYLMETHOXY-ETHOXY)-ACETAMIDE, 3-AMINO-(DIMETHYLPROPYLAMINE), 4-AMINO-(1-METHYLIMIDAZOLE)-2-CARBOXYLIC ACID, ... | Authors: | Edayathumangalam, R.S, Weyermann, P, Gottesfeld, J.M, Dervan, P.B, Luger, K. | Deposit date: | 2004-01-12 | Release date: | 2004-05-11 | Last modified: | 2023-11-15 | Method: | X-RAY DIFFRACTION (2.05 Å) | Cite: | Molecular Recognition of the Nucleosomal 'Supergroove' Proc.Natl.Acad.Sci.USA, 101, 2004
|
|
3UTA
| Crystal Structure of Nucleosome Core Particle Assembled with an Alpha-Satellite Sequence Containing Two TTAAA elements (NCP-TA2) | Descriptor: | 145-mer DNA, CHLORIDE ION, Histone H2A, ... | Authors: | Chua, E.Y.D, Vasudevan, D, Davey, G.E, Wu, B, Davey, C.A. | Deposit date: | 2011-11-25 | Release date: | 2012-04-11 | Last modified: | 2024-03-20 | Method: | X-RAY DIFFRACTION (2.07 Å) | Cite: | The mechanics behind DNA sequence-dependent properties of the nucleosome Nucleic Acids Res., 40, 2012
|
|
6WZ5
| |
3UT9
| Crystal Structure of Nucleosome Core Particle Assembled with a Palindromic Widom '601' Derivative (NCP-601L) | Descriptor: | 145-mer DNA, CHLORIDE ION, Histone H2A, ... | Authors: | Chua, E.Y.D, Vasudevan, D, Davey, G.E, Wu, B, Davey, C.A. | Deposit date: | 2011-11-25 | Release date: | 2012-04-11 | Last modified: | 2024-03-20 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | The mechanics behind DNA sequence-dependent properties of the nucleosome Nucleic Acids Res., 40, 2012
|
|
3UTB
| Crystal Structure of Nucleosome Core Particle Assembled with the 146b Alpha-Satellite Sequence (NCP146b) | Descriptor: | 146-mer DNA, Histone H2A, Histone H2B 1.1, ... | Authors: | Chua, E.Y.D, Vasudevan, D, Davey, G.E, Wu, B, Davey, C.A. | Deposit date: | 2011-11-25 | Release date: | 2012-04-11 | Last modified: | 2024-03-20 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | The mechanics behind DNA sequence-dependent properties of the nucleosome Nucleic Acids Res., 40, 2012
|
|
7TN2
| Composite model of a Chd1-nucleosome complex in the nucleotide-free state derived from 2.3A and 2.7A Cryo-EM maps | Descriptor: | Chromo domain-containing protein 1, DNA Lagging Strand, DNA Tracking Strand, ... | Authors: | Nodelman, I.M, Bowman, G.D, Armache, J.-P. | Deposit date: | 2022-01-20 | Release date: | 2022-03-02 | Last modified: | 2024-02-21 | Method: | ELECTRON MICROSCOPY (2.3 Å) | Cite: | Nucleosome recognition and DNA distortion by the Chd1 remodeler in a nucleotide-free state. Nat.Struct.Mol.Biol., 29, 2022
|
|
8G86
| Human Oct4 bound to nucleosome with human nMatn1 sequence (focused refinement of nucleosome) | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | Authors: | Sinha, K.K, Bilokapic, S, Du, Y, Malik, D, Halic, M. | Deposit date: | 2023-02-17 | Release date: | 2023-03-22 | Last modified: | 2024-06-19 | Method: | ELECTRON MICROSCOPY (2.3 Å) | Cite: | Histone modifications regulate pioneer transcription factor cooperativity. Nature, 619, 2023
|
|
8G88
| Human Oct4 bound to nucleosome with human nMatn1 sequence | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | Authors: | Sinha, K.K, Bilokapic, S, Du, Y, Malik, D, Halic, M. | Deposit date: | 2023-02-17 | Release date: | 2023-03-22 | Last modified: | 2024-06-19 | Method: | ELECTRON MICROSCOPY (2.3 Å) | Cite: | Histone modifications regulate pioneer transcription factor cooperativity. Nature, 619, 2023
|
|
1M19
| LIGAND BINDING ALTERS THE STRUCTURE AND DYNAMICS OF NUCLEOSOMAL DNA | Descriptor: | 3-AMINO-(DIMETHYLPROPYLAMINE), 4-AMINO-(1-METHYLIMIDAZOLE)-2-CARBOXYLIC ACID, 4-AMINO-(1-METHYLPYRROLE)-2-CARBOXYLIC ACID, ... | Authors: | Suto, R.K, Edayathumangalam, R.S, White, C.L, Melander, C, Gottesfeld, J.M, Dervan, P.B, Luger, K. | Deposit date: | 2002-06-18 | Release date: | 2003-02-18 | Last modified: | 2023-11-15 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | Crystal Structures of Nucleosome Core Particles in Complex with Minor Groove DNA-binding Ligands J.Mol.Biol., 326, 2003
|
|
3MGR
| Binding of Rubidium ions to the Nucleosome Core Particle | Descriptor: | CHLORIDE ION, DNA (147-MER), Histone H2A, ... | Authors: | Mohideen, K, Muhammad, R, Davey, C.A. | Deposit date: | 2010-04-07 | Release date: | 2010-06-16 | Last modified: | 2023-11-01 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | Perturbations in nucleosome structure from heavy metal association. Nucleic Acids Res., 38, 2010
|
|
1P3I
| Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | Authors: | Muthurajan, U.M, Bao, Y, Forsberg, L.J, Edayathumangalam, R.S, Dyer, P.N, White, C.L, Luger, K. | Deposit date: | 2003-04-17 | Release date: | 2004-02-24 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions EMBO J., 23, 2004
|
|
5OMX
| |
6YN1
| Crystal structure of histone chaperone APLF acidic domain bound to the histone H2A-H2B-H3-H4 octamer | Descriptor: | Aprataxin and PNK-like factor, CHLORIDE ION, GLYCEROL, ... | Authors: | Corbeski, I, Guo, X, Van Ingen, H, Sixma, T.K. | Deposit date: | 2020-04-10 | Release date: | 2021-11-17 | Last modified: | 2024-01-24 | Method: | X-RAY DIFFRACTION (2.35 Å) | Cite: | Chaperoning of the histone octamer by the acidic domain of DNA repair factor APLF. Sci Adv, 8, 2022
|
|
4KHA
| Structural basis of histone H2A-H2B recognition by the essential chaperone FACT | Descriptor: | 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, CHLORIDE ION, Histone H2A, ... | Authors: | Hondele, M, Halbach, F, Hassler, M, Ladurner, A.G. | Deposit date: | 2013-04-30 | Release date: | 2013-05-29 | Last modified: | 2024-02-28 | Method: | X-RAY DIFFRACTION (2.35 Å) | Cite: | Structural basis of histone H2A-H2B recognition by the essential chaperone FACT. Nature, 499, 2013
|
|
4J8U
| |
4XZQ
| Nucleosome disassembly by RSC and SWI/SNF is enhanced by H3 acetylation near the nucleosome dyad axis | Descriptor: | DNA (147-MER), Histone H2A, Histone H2B 1.1, ... | Authors: | Dechassa, M.L, Luger, K, Chatterjee, N, North, J.A, Manohar, M, Prasad, R, Ottessen, J.J, Poirier, M.G, Bartholomew, B. | Deposit date: | 2015-02-04 | Release date: | 2015-10-14 | Last modified: | 2024-11-06 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Histone Acetylation near the Nucleosome Dyad Axis Enhances Nucleosome Disassembly by RSC and SWI/SNF. Mol.Cell.Biol., 35, 2015
|
|
1P3L
| Crystallographic Studies of Nucleosome Core Particles containing Histone 'Sin' Mutants | Descriptor: | Histone H2A, Histone H2B, Histone H3, ... | Authors: | Muthurajan, U.M, Bao, Y, Forsberg, L.J, Edayathumangalam, R.S, Dyer, P.N, White, C.L, Luger, K. | Deposit date: | 2003-04-17 | Release date: | 2004-02-24 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Crystal structures of histone Sin mutant nucleosomes reveal altered protein-DNA interactions EMBO J., 23, 2004
|
|
4J8W
| |
3MGP
| Binding of Cobalt ions to the Nucleosome Core Particle | Descriptor: | CHLORIDE ION, COBALT (II) ION, DNA (147-MER), ... | Authors: | Mohideen, K, Muhammad, R, Davey, C.A. | Deposit date: | 2010-04-07 | Release date: | 2010-06-16 | Last modified: | 2023-11-01 | Method: | X-RAY DIFFRACTION (2.44 Å) | Cite: | Perturbations in nucleosome structure from heavy metal association. Nucleic Acids Res., 38, 2010
|
|
1M18
| LIGAND BINDING ALTERS THE STRUCTURE AND DYNAMICS OF NUCLEOSOMAL DNA | Descriptor: | Histone H2A.1, Histone H2B.1, Histone H3.2, ... | Authors: | Suto, R.K, Edayathumangalam, R.S, White, C.L, Melander, C, Gottesfeld, J.M, Dervan, P.B, Luger, K. | Deposit date: | 2002-06-18 | Release date: | 2003-02-18 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (2.45 Å) | Cite: | Crystal Structures of Nucleosome Core Particles in Complex with Minor Groove DNA-binding Ligands J.Mol.Biol., 326, 2003
|
|
4WU8
| Structure of trPtNAP-NCP145 | Descriptor: | DNA (145-MER), Histone H2A type 1, Histone H2B 1.1, ... | Authors: | Chua, E.Y.D, Davey, C.A. | Deposit date: | 2014-10-31 | Release date: | 2015-09-02 | Last modified: | 2024-03-20 | Method: | X-RAY DIFFRACTION (2.45 Å) | Cite: | Stereochemical control of nucleosome targeting by platinum-intercalator antitumor agents. Nucleic Acids Res., 43, 2015
|
|
9FH9
| Structure of CyclinB1 N-terminus bound to the NCP | Descriptor: | DNA (145-MER), G2/mitotic-specific cyclin-B1, Histone H2A type 3, ... | Authors: | Young, R.V.C, Muhammad, R, Alfieri, C. | Deposit date: | 2024-05-27 | Release date: | 2024-07-24 | Last modified: | 2024-10-16 | Method: | ELECTRON MICROSCOPY (2.5 Å) | Cite: | Spatial control of the APC/C ensures the rapid degradation of cyclin B1. Embo J., 43, 2024
|
|