1KX5
| X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution | Descriptor: | CHLORIDE ION, DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (1.94 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
1KX6
| |
1KX7
| Family of 30 conformers of a mono-heme ferrocytochrome c from Shewanella putrefaciens solved by NMR | Descriptor: | HEME C, mono-heme c-type cytochrome ScyA | Authors: | Bartalesi, I, Bertini, I, Hajieva, P, Rosato, A, Vasos, P.R. | Deposit date: | 2002-01-31 | Release date: | 2002-02-13 | Last modified: | 2022-02-23 | Method: | SOLUTION NMR | Cite: | Solution structure of a monoheme ferrocytochrome c from Shewanella putrefaciens and structural analysis of sequence-similar proteins: functional implications. Biochemistry, 41, 2002
|
|
1KX8
| Antennal Chemosensory Protein A6 from Mamestra brassicae, tetragonal form | Descriptor: | CHEMOSENSORY PROTEIN A6 | Authors: | Lartigue, A, Campanacci, V, Roussel, A, Larsson, A.M, Jones, T.A, Tegoni, M, Cambillau, C. | Deposit date: | 2002-01-31 | Release date: | 2002-12-04 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | X-Ray Structure and Ligand Binding Study of a Chemosensory Protein J.Biol.Chem., 277, 2002
|
|
1KX9
| ANTENNAL CHEMOSENSORY PROTEIN A6 FROM THE MOTH MAMESTRA BRASSICAE | Descriptor: | ACETATE ION, CHEMOSENSORY PROTEIN A6 | Authors: | Lartigue, A, Campanacci, V, Roussel, A, Larsson, A.M, Jones, T.A, Tegoni, M, Cambillau, C. | Deposit date: | 2002-01-31 | Release date: | 2002-12-04 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (1.65 Å) | Cite: | X-ray structure and ligand binding study of a moth chemosensory protein J.Biol.Chem., 277, 2002
|
|
1KXA
| |
1KXB
| |
1KXC
| |
1KXD
| |
1KXE
| |
1KXF
| |
1KXG
| The 2.0 Ang Resolution Structure of BLyS, B Lymphocyte Stimulator. | Descriptor: | 1,4-DIETHYLENE DIOXIDE, B lymphocyte stimulator, CITRIC ACID, ... | Authors: | Oren, D.A, Li, Y, Volovik, Y, Morris, T.S, Dharia, C, Das, K, Galperina, O, Gentz, R, Arnold, E. | Deposit date: | 2002-01-31 | Release date: | 2002-03-20 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Structural basis of BLyS receptor recognition. Nat.Struct.Biol., 9, 2002
|
|
1KXH
| Crystal structure of the complex between an inactive mutant of psychrophilic alpha-amylase (D174N) and acarbose | Descriptor: | 4,6-dideoxy-4-{[(1S,4R,5S,6S)-4,5,6-trihydroxy-3-(hydroxymethyl)cyclohex-2-en-1-yl]amino}-alpha-D-glucopyranose-(1-4)-alpha-D-glucopyranose-(1-4)-alpha-D-glucopyranose, CALCIUM ION, CHLORIDE ION, ... | Authors: | Aghajari, N, Haser, R. | Deposit date: | 2002-01-31 | Release date: | 2002-06-19 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | Crystallographic evidence of a transglycosylation reaction: ternary complexes of a psychrophilic alpha-amylase. Biochemistry, 41
|
|
1KXI
| STRUCTURE OF CYTOTOXIN HOMOLOG PRECURSOR | Descriptor: | CARDIOTOXIN V | Authors: | Sun, Y.-J, Wu, W.-G, Chiang, C.-M, Hsin, A.-Y, Hsiao, C.-D. | Deposit date: | 1996-08-29 | Release date: | 1997-04-21 | Last modified: | 2011-07-13 | Method: | X-RAY DIFFRACTION (2.19 Å) | Cite: | Crystal structure of cardiotoxin V from Taiwan cobra venom: pH-dependent conformational change and a novel membrane-binding motif identified in the three-finger loops of P-type cardiotoxin. Biochemistry, 36, 1997
|
|
1KXJ
| The Crystal Structure of Glutamine Amidotransferase from Thermotoga maritima | Descriptor: | Amidotransferase hisH, PHOSPHATE ION | Authors: | Korolev, S, Skarina, T, Evdokimova, E, Beasley, S, Edwards, A, Joachimiak, A, Savchenko, A, Midwest Center for Structural Genomics (MCSG) | Deposit date: | 2002-01-31 | Release date: | 2002-03-20 | Last modified: | 2024-02-14 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | Crystal structure of glutamine amidotransferase from Thermotoga maritima Proteins, 49, 2002
|
|
1KXK
| |
1KXL
| |
1KXM
| Crystal structure of Cytochrome c Peroxidase with a Proposed Electron Transfer Pathway Excised to Form a Ligand Binding Channel. | Descriptor: | BENZIMIDAZOLE, Cytochrome c Peroxidase, PROTOPORPHYRIN IX CONTAINING FE | Authors: | Rosenfeld, R.J, Hayes, A.M.A, Musah, R.A, Goodin, D.B. | Deposit date: | 2002-02-01 | Release date: | 2002-03-06 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (1.74 Å) | Cite: | Excision of a proposed electron transfer pathway in cytochrome c peroxidase and its replacement by a ligand-binding channel. Protein Sci., 11, 2002
|
|
1KXN
| Crystal Structure of Cytochrome c Peroxidase with a Proposed Electron Transfer Pathway Excised to Form a Ligand Binding Channel. | Descriptor: | PROTOPORPHYRIN IX CONTAINING FE, cytochrome c peroxidase | Authors: | Rosenfeld, R.J, Hayes, A.M.A, Musah, R.A, Goodin, D.B. | Deposit date: | 2002-02-01 | Release date: | 2002-03-06 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | Excision of a proposed electron transfer pathway in cytochrome c peroxidase and its replacement by a ligand-binding channel. Protein Sci., 11, 2002
|
|
1KXO
| ENGINEERED LIPOCALIN DIGA16 : APO-FORM | Descriptor: | DigA16 | Authors: | Korndoerfer, I.P, Skerra, A. | Deposit date: | 2002-02-01 | Release date: | 2003-06-10 | Last modified: | 2024-04-03 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | Structural mechanism of specific ligand recognition by a lipocalin tailored for the complexation of digoxigenin. J.Mol.Biol., 330, 2003
|
|
1KXP
| |
1KXQ
| Camelid VHH Domain in Complex with Porcine Pancreatic alpha-Amylase | Descriptor: | CALCIUM ION, CHLORIDE ION, alpha-amylase, ... | Authors: | Desmyter, A, Spinelli, S, Payan, F, Lauwereys, M, Wyns, L, Muyldermans, S, Cambillau, C. | Deposit date: | 2002-02-01 | Release date: | 2002-06-19 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (1.6 Å) | Cite: | Three camelid VHH domains in complex with porcine pancreatic alpha-amylase. Inhibition and versatility of binding topology. J.Biol.Chem., 277, 2002
|
|
1KXR
| Crystal Structure of Calcium-Bound Protease Core of Calpain I | Descriptor: | CALCIUM ION, thiol protease DOMAINS I AND II | Authors: | Moldoveanu, T, Hosfield, C.M, Lim, D, Elce, J.S, Jia, Z, Davies, P.L. | Deposit date: | 2002-02-01 | Release date: | 2002-03-20 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.07 Å) | Cite: | A Ca(2+) switch aligns the active site of calpain. Cell(Cambridge,Mass.), 108, 2002
|
|
1KXS
| |
1KXT
| Camelid VHH Domains in Complex with Porcine Pancreatic alpha-Amylase | Descriptor: | ALPHA-AMYLASE, PANCREATIC, CALCIUM ION, ... | Authors: | Desmyter, A, Spinelli, S, Payan, F, Lauwereys, M, Wyns, L, Muyldermans, S, Cambillau, C. | Deposit date: | 2002-02-01 | Release date: | 2002-06-19 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Three camelid VHH domains in complex with porcine pancreatic alpha-amylase. Inhibition and versatility of binding topology. J.Biol.Chem., 277, 2002
|
|