5DS9
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5ds9 by Molmil](/molmil-images/mine/5ds9) | |
5E3N
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5e3n by Molmil](/molmil-images/mine/5e3n) | |
5E3O
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5e3o by Molmil](/molmil-images/mine/5e3o) | |
5E3M
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5e3m by Molmil](/molmil-images/mine/5e3m) | Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) | Descriptor: | DNA (27-MER), DNA-binding protein Fis | Authors: | Stella, S, Hancock, S.P, Cascio, D, Johnson, R.C. | Deposit date: | 2015-10-03 | Release date: | 2016-03-09 | Last modified: | 2024-05-22 | Method: | X-RAY DIFFRACTION (2.886 Å) | Cite: | DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis. Plos One, 11, 2016
|
|
8J86
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8j86 by Molmil](/molmil-images/mine/8j86) | Monkeypox virus DNA replication holoenzyme F8, A22 and E4 complex in a DNA binding form | Descriptor: | CALCIUM ION, DNA (5'-D(P*AP*GP*CP*TP*GP*CP*TP*AP*TP*GP*TP*GP*AP*GP*AP*TP*TP*AP*AP*GP*TP*TP*AP*T)-3'), DNA (5'-D(P*GP*TP*TP*TP*TP*TP*TP*TP*TP*TP*TP*TP*TP*GP*AP*TP*AP*AP*CP*TP*TP*AP*AP*TP*CP*TP*CP*AP*CP*AP*TP*AP*GP*CP*AP*GP*CP*TP*)-3'), ... | Authors: | Xu, Y, Wu, Y, Wu, X, Zhang, Y, Yang, Y, Li, D, Yang, B, Gao, K, Zhang, Z, Dong, C. | Deposit date: | 2023-04-30 | Release date: | 2024-05-01 | Last modified: | 2024-06-05 | Method: | ELECTRON MICROSCOPY (3.22 Å) | Cite: | Structural basis of human mpox viral DNA replication inhibition by brincidofovir and cidofovir. Int.J.Biol.Macromol., 270, 2024
|
|
8J8F
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8j8f by Molmil](/molmil-images/mine/8j8f) | Monkeypox virus DNA replication holoenzyme F8, A22 and E4 in complex with a DNA duplex and dCTP | Descriptor: | 2'-DEOXYCYTIDINE-5'-TRIPHOSPHATE, CALCIUM ION, DNA (5'-D(P*AP*GP*CP*TP*GP*CP*TP*AP*TP*GP*AP*GP*AP*TP*TP*AP*AP*GP*TP*TP*AP*T)-3'), ... | Authors: | Xu, Y, Wu, Y, Wu, X, Zhang, Y, Yang, Y, Li, D, Yang, B, Gao, K, Zhang, Z, Dong, C. | Deposit date: | 2023-05-01 | Release date: | 2024-05-08 | Last modified: | 2024-06-05 | Method: | ELECTRON MICROSCOPY (2.98 Å) | Cite: | Structural basis of human mpox viral DNA replication inhibition by brincidofovir and cidofovir. Int.J.Biol.Macromol., 270, 2024
|
|
8J8G
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8j8g by Molmil](/molmil-images/mine/8j8g) | Monkeypox virus DNA replication holoenzyme F8, A22 and E4 in complex with a DNA duplex and cidofovir diphosphate | Descriptor: | CALCIUM ION, DNA (5'-D(P*AP*GP*CP*TP*GP*CP*TP*AP*TP*GP*AP*GP*AP*TP*TP*AP*AP*GP*TP*TP*AP*T)-3'), DNA (5'-D(P*GP*TP*TP*TP*TP*TP*TP*TP*TP*TP*TP*TP*TP*GP*AP*TP*AP*AP*CP*TP*TP*AP*AP*TP*CP*TP*CP*AP*CP*AP*TP*AP*GP*CP*AP*GP*CP*T)-3'), ... | Authors: | Xu, Y, Wu, Y, Wu, X, Zhang, Y, Yang, Y, Li, D, Yang, B, Gao, K, Zhang, Z, Dong, C. | Deposit date: | 2023-05-01 | Release date: | 2024-05-08 | Last modified: | 2024-06-05 | Method: | ELECTRON MICROSCOPY (2.79 Å) | Cite: | Structural basis of human mpox viral DNA replication inhibition by brincidofovir and cidofovir. Int.J.Biol.Macromol., 270, 2024
|
|
4TUI
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4tui by Molmil](/molmil-images/mine/4tui) | Crystal structure of MjMre11-DNA1 complex | Descriptor: | DNA (5'-D(P*TP*CP*CP*TP*AP*CP*GP*TP*GP*CP*CP*AP*G)-3'), DNA (5'-D(P*TP*GP*GP*CP*AP*CP*GP*TP*AP*GP*GP*AP*C)-3'), DNA double-strand break repair protein Mre11 | Authors: | Sung, S, Cho, Y. | Deposit date: | 2014-06-24 | Release date: | 2014-10-15 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (3.59 Å) | Cite: | DNA end recognition by the Mre11 nuclease dimer: insights into resection and repair of damaged DNA. Embo J., 33, 2014
|
|
4TUG
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4tug by Molmil](/molmil-images/mine/4tug) | Crystal structure of MjMre11-DNA2 complex | Descriptor: | DNA (5'-D(P*CP*TP*GP*TP*CP*CP*TP*AP*CP*GP*TP*GP*CP*CP*A)-3'), DNA (5'-D(P*GP*CP*AP*CP*GP*TP*AP*GP*GP*AP*CP*AP*GP*C)-3'), DNA double-strand break repair protein Mre11, ... | Authors: | Sung, S, Cho, Y. | Deposit date: | 2014-06-24 | Release date: | 2014-10-15 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (3.55 Å) | Cite: | DNA end recognition by the Mre11 nuclease dimer: insights into resection and repair of damaged DNA. Embo J., 33, 2014
|
|
4KDP
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4kdp by Molmil](/molmil-images/mine/4kdp) | TcaR-ssDNA complex crystal structure reveals the novel ssDNA binding mechanism of the MarR family proteins | Descriptor: | 1,2-ETHANEDIOL, 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, DNA (5'-D(*CP*GP*CP*AP*GP*CP*GP*CP*GP*CP*AP*GP*CP*CP*CP*TP*A)-3'), ... | Authors: | Chang, Y.M, Chen, C.K.-M, Wang, A.H.-J. | Deposit date: | 2013-04-25 | Release date: | 2014-03-19 | Last modified: | 2023-09-20 | Method: | X-RAY DIFFRACTION (3.6 Å) | Cite: | TcaR-ssDNA complex crystal structure reveals new DNA binding mechanism of the MarR family proteins. Nucleic Acids Res., 42, 2014
|
|
5WFE
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5wfe by Molmil](/molmil-images/mine/5wfe) | Cas1-Cas2-IHF-DNA holo-complex | Descriptor: | CRISPR-associated endonuclease Cas1, CRISPR-associated endoribonuclease Cas2, DNA (28-MER), ... | Authors: | Wright, A.V, Liu, J.J, Nogales, E, Doudna, J.A. | Deposit date: | 2017-07-11 | Release date: | 2017-08-02 | Last modified: | 2024-03-13 | Method: | ELECTRON MICROSCOPY (3.64 Å) | Cite: | Structures of the CRISPR genome integration complex. Science, 357, 2017
|
|
4TPS
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4tps by Molmil](/molmil-images/mine/4tps) | Sporulation Inhibitor of DNA Replication, SirA, in complex with Domain I of DnaA | Descriptor: | ACETATE ION, BETA-MERCAPTOETHANOL, Chromosomal replication initiator protein DnaA, ... | Authors: | Jameson, K.H, Turkenburg, J.P, Fogg, M.J, Grahl, A, Wilkinson, A.J. | Deposit date: | 2014-06-09 | Release date: | 2014-07-30 | Last modified: | 2024-04-03 | Method: | X-RAY DIFFRACTION (1.65 Å) | Cite: | Structure and interactions of the Bacillus subtilis sporulation inhibitor of DNA replication, SirA, with domain I of DnaA. Mol.Microbiol., 93, 2014
|
|
4HC7
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4hc7 by Molmil](/molmil-images/mine/4hc7) | Crystal structure of the full DNA binding domain of GATA3-complex 2 | Descriptor: | DNA (5'-D(*AP*AP*GP*GP*TP*TP*AP*TP*CP*TP*CP*TP*GP*AP*TP*TP*TP*AP*GP*G)-3'), DNA (5'-D(*TP*TP*CP*CP*TP*AP*AP*AP*TP*CP*AP*GP*AP*GP*AP*TP*AP*AP*CP*C)-3'), Trans-acting T-cell-specific transcription factor GATA-3, ... | Authors: | Chen, Y, Bates, D.L, Dey, R, Chen, L. | Deposit date: | 2012-09-28 | Release date: | 2012-12-05 | Last modified: | 2024-02-28 | Method: | X-RAY DIFFRACTION (2.65 Å) | Cite: | DNA Binding by GATA Transcription Factor Suggests Mechanisms of DNA Looping and Long-Range Gene Regulation. Cell Rep, 2, 2012
|
|
6NY2
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6ny2 by Molmil](/molmil-images/mine/6ny2) | CasX-gRNA-DNA(45bp) state I | Descriptor: | CasX, DNA Non-target strand, DNA target strand, ... | Authors: | Liu, J.J, Orlova, N, Nogales, E, Doudna, J.A. | Deposit date: | 2019-02-10 | Release date: | 2019-02-27 | Last modified: | 2019-12-25 | Method: | ELECTRON MICROSCOPY (3.2 Å) | Cite: | CasX enzymes comprise a distinct family of RNA-guided genome editors. Nature, 566, 2019
|
|
6NY1
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6ny1 by Molmil](/molmil-images/mine/6ny1) | CasX-gRNA-DNA(30bp) State II | Descriptor: | CasX, DNA Non-target strand, DNA target strand, ... | Authors: | Liu, J.J, Orlova, N, Nogales, E, Doudna, J.A. | Deposit date: | 2019-02-10 | Release date: | 2019-02-27 | Last modified: | 2024-03-13 | Method: | ELECTRON MICROSCOPY (4.2 Å) | Cite: | CasX enzymes comprise a distinct family of RNA-guided genome editors. Nature, 566, 2019
|
|
4RIA
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4ria by Molmil](/molmil-images/mine/4ria) | FAN1 Nuclease bound to 5' phosphorylated nicked DNA | Descriptor: | BARIUM ION, DNA (5'-D(*TP*TP*TP*TP*TP*TP*G*AP*GP*GP*CP*GP*TP*G)-3'), DNA (5'-D(P*AP*GP*AP*CP*TP*CP*CP*TP*C)-3'), ... | Authors: | Pavletich, N.P, Wang, R. | Deposit date: | 2014-10-05 | Release date: | 2014-12-10 | Last modified: | 2024-02-28 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | DNA repair. Mechanism of DNA interstrand cross-link processing by repair nuclease FAN1. Science, 346, 2014
|
|
4RI9
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4ri9 by Molmil](/molmil-images/mine/4ri9) | |
5U01
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5u01 by Molmil](/molmil-images/mine/5u01) | Cooperative DNA binding by two RelA dimers | Descriptor: | DNA (27-MER), Transcription factor p65 | Authors: | Ghosh, G, Huang, D. | Deposit date: | 2016-11-22 | Release date: | 2017-09-27 | Last modified: | 2023-10-04 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | DNA-binding affinity and transcriptional activity of the RelA homodimer of nuclear factor kappa B are not correlated. J. Biol. Chem., 292, 2017
|
|
4RIC
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4ric by Molmil](/molmil-images/mine/4ric) | FAN1 Nuclease bound to 5' hydroxyl (dT-dT) single flap DNA | Descriptor: | CALCIUM ION, DNA (5'-D(*GP*CP*TP*GP*AP*GP*GP*AP*GP*TP*CP*T)-3'), DNA (5'-D(*TP*TP*AP*GP*CP*CP*AP*CP*GP*CP*CP*TP*AP*GP*AP*CP*TP*CP*CP*TP*C)-3'), ... | Authors: | Pavletich, N.P, Wang, R. | Deposit date: | 2014-10-05 | Release date: | 2014-12-03 | Last modified: | 2024-02-28 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | DNA repair. Mechanism of DNA interstrand cross-link processing by repair nuclease FAN1. Science, 346, 2014
|
|
4RIB
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4rib by Molmil](/molmil-images/mine/4rib) | FAN1 Nuclease bound to 5' phosphorylated p(dT) single flap DNA | Descriptor: | CALCIUM ION, DNA (5'-D(*GP*CP*TP*GP*AP*GP*GP*AP*GP*TP*CP*T)-3'), DNA (5'-D(*TP*TP*TP*TP*TP*TP*GP*AP*GP*GP*CP*GP*TP*G)-3'), ... | Authors: | Pavletich, N.P, Wang, R. | Deposit date: | 2014-10-05 | Release date: | 2014-12-03 | Last modified: | 2024-02-28 | Method: | X-RAY DIFFRACTION (3.25 Å) | Cite: | DNA repair. Mechanism of DNA interstrand cross-link processing by repair nuclease FAN1. Science, 346, 2014
|
|
4RI8
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4ri8 by Molmil](/molmil-images/mine/4ri8) | |
6UEP
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6uep by Molmil](/molmil-images/mine/6uep) | |
6UEO
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6ueo by Molmil](/molmil-images/mine/6ueo) | Structure of A. thaliana TBP-AC mismatch DNA site | Descriptor: | DNA (5'-D(*GP*CP*TP*AP*TP*AP*AP*AP*AP*GP*GP*GP*CP*A)-3'), DNA (5'-D(*TP*GP*CP*CP*CP*CP*TP*TP*TP*AP*TP*AP*GP*C)-3'), TATA-box-binding protein 1 | Authors: | Schumacher, M.A. | Deposit date: | 2019-09-22 | Release date: | 2020-09-02 | Last modified: | 2023-10-11 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | DNA mismatches reveal conformational penalties in protein-DNA recognition. Nature, 587, 2020
|
|
4XRS
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4xrs by Molmil](/molmil-images/mine/4xrs) | Heterodimeric complex of transcription factors MEIS1 and DLX3 on specific DNA | Descriptor: | DNA (5'-D(P*AP*CP*AP*AP*TP*TP*AP*TP*CP*CP*TP*GP*TP*CP*AP*AP*C)-3'), DNA (5'-D(P*CP*AP*AP*TP*TP*AP*TP*CP*CP*TP*GP*TP*CP*AP*A)-3'), DNA (5'-D(P*GP*TP*TP*GP*AP*CP*AP*GP*GP*AP*TP*AP*AP*TP*TP*GP*TP*T)-3'), ... | Authors: | Jorma, A, Yin, Y, Nitta, K.R, Dave, K, Enge, M, Kivioja, T, Popov, A, Morgunova, E, Taipale, J. | Deposit date: | 2015-01-21 | Release date: | 2015-11-04 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (3.5 Å) | Cite: | DNA-dependent formation of transcription factor pairs alters their binding specificity. Nature, 527, 2015
|
|
4G92
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4g92 by Molmil](/molmil-images/mine/4g92) | CCAAT-binding complex from Aspergillus nidulans with DNA | Descriptor: | DNA, HAPB protein, HapE, ... | Authors: | Huber, E.M, Scharf, D.H, Hortschansky, P, Groll, M, Brakhage, A.A. | Deposit date: | 2012-07-23 | Release date: | 2012-10-31 | Last modified: | 2023-09-13 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | DNA Minor Groove Sensing and Widening by the CCAAT-Binding Complex. Structure, 20, 2012
|
|