5E3M
 
 | | Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) | | Descriptor: | DNA (27-MER), DNA-binding protein Fis | | Authors: | Stella, S, Hancock, S.P, Cascio, D, Johnson, R.C. | | Deposit date: | 2015-10-03 | | Release date: | 2016-03-09 | | Last modified: | 2024-05-22 | | Method: | X-RAY DIFFRACTION (2.886 Å) | | Cite: | DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.
Plos One, 11, 2016
|
|
5E3O
 | |
5DS9
 | |
8J8G
 | | Monkeypox virus DNA replication holoenzyme F8, A22 and E4 in complex with a DNA duplex and cidofovir diphosphate | | Descriptor: | CALCIUM ION, DNA (5'-D(P*AP*GP*CP*TP*GP*CP*TP*AP*TP*GP*AP*GP*AP*TP*TP*AP*AP*GP*TP*TP*AP*T)-3'), DNA (5'-D(P*GP*TP*TP*TP*TP*TP*TP*TP*TP*TP*TP*TP*TP*GP*AP*TP*AP*AP*CP*TP*TP*AP*AP*TP*CP*TP*CP*AP*CP*AP*TP*AP*GP*CP*AP*GP*CP*T)-3'), ... | | Authors: | Xu, Y, Wu, Y, Wu, X, Zhang, Y, Yang, Y, Li, D, Yang, B, Gao, K, Zhang, Z, Dong, C. | | Deposit date: | 2023-05-01 | | Release date: | 2024-05-08 | | Last modified: | 2025-07-02 | | Method: | ELECTRON MICROSCOPY (2.79 Å) | | Cite: | Structural basis of human mpox viral DNA replication inhibition by brincidofovir and cidofovir.
Int.J.Biol.Macromol., 270, 2024
|
|
8J8F
 | | Monkeypox virus DNA replication holoenzyme F8, A22 and E4 in complex with a DNA duplex and dCTP | | Descriptor: | 2'-DEOXYCYTIDINE-5'-TRIPHOSPHATE, CALCIUM ION, DNA (5'-D(P*AP*GP*CP*TP*GP*CP*TP*AP*TP*GP*AP*GP*AP*TP*TP*AP*AP*GP*TP*TP*AP*T)-3'), ... | | Authors: | Xu, Y, Wu, Y, Wu, X, Zhang, Y, Yang, Y, Li, D, Yang, B, Gao, K, Zhang, Z, Dong, C. | | Deposit date: | 2023-05-01 | | Release date: | 2024-05-08 | | Last modified: | 2025-07-02 | | Method: | ELECTRON MICROSCOPY (2.98 Å) | | Cite: | Structural basis of human mpox viral DNA replication inhibition by brincidofovir and cidofovir.
Int.J.Biol.Macromol., 270, 2024
|
|
5WFE
 | | Cas1-Cas2-IHF-DNA holo-complex | | Descriptor: | CRISPR-associated endonuclease Cas1, CRISPR-associated endoribonuclease Cas2, DNA (28-MER), ... | | Authors: | Wright, A.V, Liu, J.J, Nogales, E, Doudna, J.A. | | Deposit date: | 2017-07-11 | | Release date: | 2017-08-02 | | Last modified: | 2024-03-13 | | Method: | ELECTRON MICROSCOPY (3.64 Å) | | Cite: | Structures of the CRISPR genome integration complex.
Science, 357, 2017
|
|
4KDP
 | | TcaR-ssDNA complex crystal structure reveals the novel ssDNA binding mechanism of the MarR family proteins | | Descriptor: | 1,2-ETHANEDIOL, 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, DNA (5'-D(*CP*GP*CP*AP*GP*CP*GP*CP*GP*CP*AP*GP*CP*CP*CP*TP*A)-3'), ... | | Authors: | Chang, Y.M, Chen, C.K.-M, Wang, A.H.-J. | | Deposit date: | 2013-04-25 | | Release date: | 2014-03-19 | | Last modified: | 2023-09-20 | | Method: | X-RAY DIFFRACTION (3.6 Å) | | Cite: | TcaR-ssDNA complex crystal structure reveals new DNA binding mechanism of the MarR family proteins.
Nucleic Acids Res., 42, 2014
|
|
5LUQ
 | | Crystal Structure of Human DNA-dependent Protein Kinase Catalytic Subunit (DNA-PKcs) | | Descriptor: | C-terminal fragment of KU80 (KU80ct194), DNA-dependent protein kinase catalytic subunit,DNA-dependent Protein Kinase Catalytic Subunit,DNA-dependent protein kinase catalytic subunit | | Authors: | Sibanda, B.L, Chirgadze, D.Y, Ascher, D.B, Blundell, T.L. | | Deposit date: | 2016-09-09 | | Release date: | 2017-02-15 | | Last modified: | 2024-10-23 | | Method: | X-RAY DIFFRACTION (4.3 Å) | | Cite: | DNA-PKcs structure suggests an allosteric mechanism modulating DNA double-strand break repair.
Science, 355, 2017
|
|
8J86
 | | Monkeypox virus DNA replication holoenzyme F8, A22 and E4 complex in a DNA binding form | | Descriptor: | CALCIUM ION, DNA (5'-D(P*AP*GP*CP*TP*GP*CP*TP*AP*TP*GP*TP*GP*AP*GP*AP*TP*TP*AP*AP*GP*TP*TP*AP*T)-3'), DNA (5'-D(P*GP*TP*TP*TP*TP*TP*TP*TP*TP*TP*TP*TP*TP*GP*AP*TP*AP*AP*CP*TP*TP*AP*AP*TP*CP*TP*CP*AP*CP*AP*TP*AP*GP*CP*AP*GP*CP*TP*)-3'), ... | | Authors: | Xu, Y, Wu, Y, Wu, X, Zhang, Y, Yang, Y, Li, D, Yang, B, Gao, K, Zhang, Z, Dong, C. | | Deposit date: | 2023-04-30 | | Release date: | 2024-05-01 | | Last modified: | 2025-07-02 | | Method: | ELECTRON MICROSCOPY (3.22 Å) | | Cite: | Structural basis of human mpox viral DNA replication inhibition by brincidofovir and cidofovir.
Int.J.Biol.Macromol., 270, 2024
|
|
8BYX
 | |
8BZM
 | | FOXK1-ELF1-heterodimer bound to DNA | | Descriptor: | DNA, ETS-related transcription factor Elf-1, Forkhead box protein K1, ... | | Authors: | Morgunova, E, Popov, A, Yin, Y, Taipale, J. | | Deposit date: | 2022-12-15 | | Release date: | 2023-12-27 | | Last modified: | 2025-04-23 | | Method: | X-RAY DIFFRACTION (2.69 Å) | | Cite: | DNA-guided transcription factor interactions extend human gene regulatory code.
Nature, 2025
|
|
4GXI
 | | R283K DNA polymerase beta binary complex with a templating 8OG | | Descriptor: | DNA (5'-D(*CP*CP*GP*AP*CP*(8OG)P*TP*CP*GP*CP*AP*TP*CP*AP*GP*C)-3'), DNA (5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*A)-3'), DNA (5'-D(P*GP*TP*CP*GP*G)-3'), ... | | Authors: | Freudenthal, B.D, Beard, W.A, Wilson, S.H. | | Deposit date: | 2012-09-04 | | Release date: | 2013-01-16 | | Last modified: | 2023-09-13 | | Method: | X-RAY DIFFRACTION (1.949 Å) | | Cite: | DNA polymerase minor groove interactions modulate mutagenic bypass of a templating 8-oxoguanine lesion.
Nucleic Acids Res., 41, 2013
|
|
4HC7
 | | Crystal structure of the full DNA binding domain of GATA3-complex 2 | | Descriptor: | DNA (5'-D(*AP*AP*GP*GP*TP*TP*AP*TP*CP*TP*CP*TP*GP*AP*TP*TP*TP*AP*GP*G)-3'), DNA (5'-D(*TP*TP*CP*CP*TP*AP*AP*AP*TP*CP*AP*GP*AP*GP*AP*TP*AP*AP*CP*C)-3'), Trans-acting T-cell-specific transcription factor GATA-3, ... | | Authors: | Chen, Y, Bates, D.L, Dey, R, Chen, L. | | Deposit date: | 2012-09-28 | | Release date: | 2012-12-05 | | Last modified: | 2024-02-28 | | Method: | X-RAY DIFFRACTION (2.65 Å) | | Cite: | DNA Binding by GATA Transcription Factor Suggests Mechanisms of DNA Looping and Long-Range Gene Regulation.
Cell Rep, 2, 2012
|
|
4XRS
 | | Heterodimeric complex of transcription factors MEIS1 and DLX3 on specific DNA | | Descriptor: | DNA (5'-D(P*AP*CP*AP*AP*TP*TP*AP*TP*CP*CP*TP*GP*TP*CP*AP*AP*C)-3'), DNA (5'-D(P*CP*AP*AP*TP*TP*AP*TP*CP*CP*TP*GP*TP*CP*AP*A)-3'), DNA (5'-D(P*GP*TP*TP*GP*AP*CP*AP*GP*GP*AP*TP*AP*AP*TP*TP*GP*TP*T)-3'), ... | | Authors: | Jorma, A, Yin, Y, Nitta, K.R, Dave, K, Enge, M, Kivioja, T, Popov, A, Morgunova, E, Taipale, J. | | Deposit date: | 2015-01-21 | | Release date: | 2015-11-04 | | Last modified: | 2024-01-10 | | Method: | X-RAY DIFFRACTION (3.5 Å) | | Cite: | DNA-dependent formation of transcription factor pairs alters their binding specificity.
Nature, 527, 2015
|
|
8K8S
 | | F8-A22-E4 complex of MPXV in complex with DNA and Ara-CTP | | Descriptor: | 4-amino-1-{5-O-[(S)-hydroxy{[(R)-hydroxy(phosphonooxy)phosphoryl]oxy}phosphoryl]-beta-D-arabinofuranosyl}pyrimidin-2(1H)-one, DNA (5'-D(*AP*TP*CP*CP*TP*CP*CP*CP*CP*TP*AP*C)-3'), DNA (5'-D(P*TP*AP*GP*GP*TP*AP*GP*GP*GP*GP*AP*GP*GP*AP*T)-3'), ... | | Authors: | Shen, Y.P, Li, Y.N, Yan, R.H. | | Deposit date: | 2023-07-31 | | Release date: | 2024-06-05 | | Last modified: | 2024-06-19 | | Method: | ELECTRON MICROSCOPY (3.06 Å) | | Cite: | Structural basis for the inhibition mechanism of the DNA polymerase holoenzyme from mpox virus.
Structure, 32, 2024
|
|
8K8U
 | | F8-A22-E4 complex of MPXV in complex with DNA and dCTP | | Descriptor: | CYTIDINE-5'-TRIPHOSPHATE, DNA (5'-D(*AP*TP*CP*CP*TP*CP*CP*CP*CP*TP*AP*C)-3'), DNA (5'-D(P*AP*AP*GP*GP*TP*AP*GP*GP*GP*GP*AP*GP*GP*AP*T)-3'), ... | | Authors: | Shen, Y.P, Li, Y.N, Yan, R.H. | | Deposit date: | 2023-07-31 | | Release date: | 2024-06-05 | | Last modified: | 2024-06-19 | | Method: | ELECTRON MICROSCOPY (3.05 Å) | | Cite: | Structural basis for the inhibition mechanism of the DNA polymerase holoenzyme from mpox virus.
Structure, 32, 2024
|
|
5U01
 | | Cooperative DNA binding by two RelA dimers | | Descriptor: | DNA (27-MER), Transcription factor p65 | | Authors: | Ghosh, G, Huang, D. | | Deposit date: | 2016-11-22 | | Release date: | 2017-09-27 | | Last modified: | 2023-10-04 | | Method: | X-RAY DIFFRACTION (2.5 Å) | | Cite: | DNA-binding affinity and transcriptional activity of the RelA homodimer of nuclear factor kappa B are not correlated.
J. Biol. Chem., 292, 2017
|
|
5EG0
 | | HOXB13-MEIS1 heterodimer bound to DNA | | Descriptor: | DNA (5'-D(*CP*CP*TP*CP*GP*TP*AP*AP*AP*AP*CP*TP*GP*TP*CP*AP*AP*C)-3'), DNA (5'-D(P*GP*TP*TP*GP*AP*CP*AP*GP*TP*TP*TP*TP*AP*CP*GP*AP*GP*G)-3'), Homeobox protein Hox-B13, ... | | Authors: | Morgunova, E, Yin, Y, Jolma, A, Popov, A, Taipale, J. | | Deposit date: | 2015-10-26 | | Release date: | 2016-11-09 | | Last modified: | 2025-04-23 | | Method: | X-RAY DIFFRACTION (3.101 Å) | | Cite: | DNA-guided transcription factor interactions extend human gene regulatory code.
Nature, 2025
|
|
4G92
 | | CCAAT-binding complex from Aspergillus nidulans with DNA | | Descriptor: | DNA, HAPB protein, HapE, ... | | Authors: | Huber, E.M, Scharf, D.H, Hortschansky, P, Groll, M, Brakhage, A.A. | | Deposit date: | 2012-07-23 | | Release date: | 2012-10-31 | | Last modified: | 2023-09-13 | | Method: | X-RAY DIFFRACTION (1.8 Å) | | Cite: | DNA Minor Groove Sensing and Widening by the CCAAT-Binding Complex.
Structure, 20, 2012
|
|
6UEP
 | |
6UEO
 | | Structure of A. thaliana TBP-AC mismatch DNA site | | Descriptor: | DNA (5'-D(*GP*CP*TP*AP*TP*AP*AP*AP*AP*GP*GP*GP*CP*A)-3'), DNA (5'-D(*TP*GP*CP*CP*CP*CP*TP*TP*TP*AP*TP*AP*GP*C)-3'), TATA-box-binding protein 1 | | Authors: | Schumacher, M.A. | | Deposit date: | 2019-09-22 | | Release date: | 2020-09-02 | | Last modified: | 2023-10-11 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | DNA mismatches reveal conformational penalties in protein-DNA recognition.
Nature, 587, 2020
|
|
1BD1
 | | CRYSTALLOGRAPHIC STUDY OF ONE TURN OF G/C-RICH B-DNA | | Descriptor: | DNA (5'-D(*CP*CP*AP*GP*GP*CP*CP*TP*GP*G)-3'), TRIETHYLAMMONIUM ION | | Authors: | Heinemann, U. | | Deposit date: | 1989-08-16 | | Release date: | 1990-01-15 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (1.6 Å) | | Cite: | Crystallographic study of one turn of G/C-rich B-DNA.
J.Mol.Biol., 210, 1989
|
|
3G6V
 | |
3G6Y
 | |
6NY2
 | | CasX-gRNA-DNA(45bp) state I | | Descriptor: | CasX, DNA Non-target strand, DNA target strand, ... | | Authors: | Liu, J.J, Orlova, N, Nogales, E, Doudna, J.A. | | Deposit date: | 2019-02-10 | | Release date: | 2019-02-27 | | Last modified: | 2024-11-06 | | Method: | ELECTRON MICROSCOPY (3.2 Å) | | Cite: | CasX enzymes comprise a distinct family of RNA-guided genome editors.
Nature, 566, 2019
|
|
