1KX3
 
 | | X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution | | Descriptor: | DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3'), MANGANESE (II) ION, histone H2A.1, ... | | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | | Deposit date: | 2002-01-31 | | Release date: | 2002-12-25 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution
J.Mol.Biol., 319, 2002
|
|
3U3Y
 | | Mouse TREX1 D200H mutant | | Descriptor: | 1,4-BUTANEDIOL, 5'-D(*GP*AP*CP*G)-3', CALCIUM ION, ... | | Authors: | Bailey, S.L, Harvey, S, Perrino, F.W, Hollis, T. | | Deposit date: | 2011-10-06 | | Release date: | 2011-12-28 | | Last modified: | 2024-02-28 | | Method: | X-RAY DIFFRACTION (2.28 Å) | | Cite: | Defects in DNA degradation revealed in crystal structures of TREX1 exonuclease mutations linked to autoimmune disease.
Dna Repair, 11, 2012
|
|
4N1O
 | |
7OAT
 | | Structural basis for targeted p97 remodelling by ASPL as prerequisite for p97 trimethylation by METTL21D | | Descriptor: | 1,2-ETHANEDIOL, ADENOSINE-5'-TRIPHOSPHATE, MAGNESIUM ION, ... | | Authors: | Petrovic, S, Heinemann, U, Roske, Y. | | Deposit date: | 2021-04-20 | | Release date: | 2022-08-03 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (2.995 Å) | | Cite: | Structural remodeling of AAA+ ATPase p97 by adaptor protein ASPL facilitates posttranslational methylation by METTL21D.
Proc.Natl.Acad.Sci.USA, 120, 2023
|
|
3HJZ
 | | The structure of an aldolase from Prochlorococcus marinus | | Descriptor: | 1,2-ETHANEDIOL, CHLORIDE ION, DI(HYDROXYETHYL)ETHER, ... | | Authors: | Singer, A.U, Xu, X, Cui, H, Joachimiak, A, Edwards, A.M, Savchenko, A, Midwest Center for Structural Genomics (MCSG) | | Deposit date: | 2009-05-22 | | Release date: | 2009-06-09 | | Last modified: | 2024-11-20 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | Phage auxiliary metabolic genes and the redirection of cyanobacterial host carbon metabolism.
Proc.Natl.Acad.Sci.USA, 108, 2011
|
|
4Y5H
 | |
1U8K
 | |
6SIM
 | | SAD structure of Hen Egg White Lysozyme recovered by inverse beam geometry data collection and univariate analysis | | Descriptor: | 1,2-ETHANEDIOL, ACETATE ION, CHLORIDE ION, ... | | Authors: | Garcia-Bonete, M.J, Katona, G. | | Deposit date: | 2019-08-10 | | Release date: | 2019-11-06 | | Last modified: | 2024-10-16 | | Method: | X-RAY DIFFRACTION (1.61018026 Å) | | Cite: | Bayesian machine learning improves single-wavelength anomalous diffraction phasing.
Acta Crystallogr.,Sect.A, 75, 2019
|
|
6SIS
 | | Crystal structure of macrocyclic PROTAC 1 in complex with the second bromodomain of human Brd4 and pVHL:ElonginC:ElonginB | | Descriptor: | Bromodomain-containing protein 4, Elongin-B, Elongin-C, ... | | Authors: | Hughes, S.J, Testa, A, Ciulli, A. | | Deposit date: | 2019-08-10 | | Release date: | 2019-12-04 | | Last modified: | 2024-01-24 | | Method: | X-RAY DIFFRACTION (3.5 Å) | | Cite: | Structure-Based Design of a Macrocyclic PROTAC.
Angew.Chem.Int.Ed.Engl., 59, 2020
|
|
4ECP
 | |
6SXR
 | | E221Q mutant of GH54 a-l-arabinofuranosidase soaked with 4-nitrophenyl a-l-arabinofuranoside | | Descriptor: | 1,2-ETHANEDIOL, 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, ... | | Authors: | McGregor, N.G.S, Davies, G.J, Nin-Hill, A, Rovira, C. | | Deposit date: | 2019-09-26 | | Release date: | 2020-02-26 | | Last modified: | 2024-10-23 | | Method: | X-RAY DIFFRACTION (1.64 Å) | | Cite: | Rational Design of Mechanism-Based Inhibitors and Activity-Based Probes for the Identification of Retaining alpha-l-Arabinofuranosidases.
J.Am.Chem.Soc., 142, 2020
|
|
3TOA
 | | Human MOF crystal structure with active site lysine partially acetylated | | Descriptor: | 1,2-ETHANEDIOL, CHLORIDE ION, ZINC ION, ... | | Authors: | Yuan, H, Ding, E.C, Marmorstein, R. | | Deposit date: | 2011-09-04 | | Release date: | 2011-11-09 | | Last modified: | 2024-10-30 | | Method: | X-RAY DIFFRACTION (3.004 Å) | | Cite: | MYST protein acetyltransferase activity requires active site lysine autoacetylation.
Embo J., 31, 2011
|
|
7OKC
 | | Crystal structure of Escherichia coli LpxA in complex with compound 1 | | Descriptor: | 2-[2-(2-chlorophenyl)sulfanylethanoyl-[[4-(1,2,4-triazol-1-yl)phenyl]methyl]amino]-N-methyl-ethanamide, Acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase, SODIUM ION | | Authors: | Ryan, M.D, Parkes, A.L, Southey, M, Andersen, O.A, Zahn, M, Barker, J, DeJonge, B.L.M. | | Deposit date: | 2021-05-17 | | Release date: | 2021-10-06 | | Last modified: | 2024-01-31 | | Method: | X-RAY DIFFRACTION (1.84 Å) | | Cite: | Discovery of Novel UDP- N -Acetylglucosamine Acyltransferase (LpxA) Inhibitors with Activity against Pseudomonas aeruginosa .
J.Med.Chem., 64, 2021
|
|
6SP5
 | | Structure of hyperstable haloalkane dehalogenase variant DhaA115 | | Descriptor: | 2-[3-(2-HYDROXY-1,1-DIHYDROXYMETHYL-ETHYLAMINO)-PROPYLAMINO]-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, GLYCEROL, Haloalkane dehalogenase, ... | | Authors: | Chmelova, K, Markova, K, Damborsky, J, Marek, M. | | Deposit date: | 2019-08-30 | | Release date: | 2020-11-18 | | Last modified: | 2024-01-24 | | Method: | X-RAY DIFFRACTION (1.6 Å) | | Cite: | Decoding the intricate network of molecular interactions of a hyperstable engineered biocatalyst.
Chem Sci, 11, 2020
|
|
4N5V
 | | Alternative substrates of Mycobacterium tuberculosis anthranilate phosphoribosyl transferase | | Descriptor: | 1-O-pyrophosphono-5-O-phosphono-alpha-D-ribofuranose, 2-amino-4-fluorobenzoic acid, Anthranilate phosphoribosyltransferase, ... | | Authors: | Castell, A, Cookson, T.V.M, Parker, E.J, Baker, E.N, Lott, J.S. | | Deposit date: | 2013-10-10 | | Release date: | 2014-04-23 | | Last modified: | 2023-09-20 | | Method: | X-RAY DIFFRACTION (1.9 Å) | | Cite: | Alternative substrates reveal catalytic cycle and key binding events in the reaction catalysed by anthranilate phosphoribosyltransferase from Mycobacterium tuberculosis.
Biochem.J., 461, 2014
|
|
6DOG
 | |
6DP7
 | |
6DPN
 | |
6DPD
 | |
7ORZ
 | | Crystal structure of UDP-N-acetylenolpyruvoylglucosamine reductase (MurB) from Pseudomonas aeruginosa in complex with FAD and a pyrazole derivative (fragment 18) | | Descriptor: | 1-phenyl-5-(trifluoromethyl)pyrazole-4-carboxylic acid, FLAVIN-ADENINE DINUCLEOTIDE, GLYCEROL, ... | | Authors: | Acebron-Garcia de Eulate, M, Blundell, T.L, Kim, S.Y, Mendes, V, Abell, C. | | Deposit date: | 2021-06-06 | | Release date: | 2021-11-03 | | Last modified: | 2024-01-31 | | Method: | X-RAY DIFFRACTION (1.85 Å) | | Cite: | Discovery of Novel Inhibitors of Uridine Diphosphate- N -Acetylenolpyruvylglucosamine Reductase (MurB) from Pseudomonas aeruginosa , an Opportunistic Infectious Agent Causing Death in Cystic Fibrosis Patients.
J.Med.Chem., 65, 2022
|
|
3TZU
 | |
4N02
 | | Type 2 IDI from S. pneumoniae | | Descriptor: | 1-DEOXY-1-(7,8-DIMETHYL-2,4-DIOXO-3,4-DIHYDRO-2H-BENZO[G]PTERIDIN-1-ID-10(5H)-YL)-5-O-PHOSPHONATO-D-RIBITOL, Isopentenyl-diphosphate delta-isomerase, SULFATE ION | | Authors: | de Ruyck, J, Schubert, H.L, Poulter, C.D. | | Deposit date: | 2013-09-30 | | Release date: | 2014-07-02 | | Last modified: | 2024-02-28 | | Method: | X-RAY DIFFRACTION (1.4 Å) | | Cite: | Determination of Kinetics and the Crystal Structure of a Novel Type 2 Isopentenyl Diphosphate: Dimethylallyl Diphosphate Isomerase from Streptococcus pneumoniae.
Chembiochem, 15, 2014
|
|
7O7K
 | | Crystal structure of the human DYRK1A kinase domain bound to abemaciclib | | Descriptor: | 1,2-ETHANEDIOL, CITRATE ANION, DI(HYDROXYETHYL)ETHER, ... | | Authors: | Kaltheuner, I.H, Anand, K, Geyer, M. | | Deposit date: | 2021-04-13 | | Release date: | 2021-11-24 | | Last modified: | 2024-10-09 | | Method: | X-RAY DIFFRACTION (1.82 Å) | | Cite: | Abemaciclib is a potent inhibitor of DYRK1A and HIP kinases involved in transcriptional regulation.
Nat Commun, 12, 2021
|
|
3U2D
 | | S. aureus GyrB ATPase domain in complex with small molecule inhibitor | | Descriptor: | 4-bromo-5-methyl-N-[1-(3-nitropyridin-2-yl)piperidin-4-yl]-1H-pyrrole-2-carboxamide, DNA gyrase subunit B, MAGNESIUM ION | | Authors: | Boriack-Sjodin, P.A, Prince, D.B, Eakin, A.E, Sherer, B.A. | | Deposit date: | 2011-10-03 | | Release date: | 2012-01-11 | | Last modified: | 2024-02-28 | | Method: | X-RAY DIFFRACTION (1.85 Å) | | Cite: | Pyrrolamide DNA gyrase inhibitors: fragment-based nuclear magnetic resonance screening to identify antibacterial agents.
Antimicrob.Agents Chemother., 56, 2012
|
|
6ZZ3
 | | RBcel1 cellulase variant Y201F with cellotriose covalently bound | | Descriptor: | 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, Endoglucanase, beta-D-glucopyranose-(1-4)-beta-D-glucopyranose-(1-4)-alpha-D-glucopyranose | | Authors: | Collet, L, Dutoit, R. | | Deposit date: | 2020-08-03 | | Release date: | 2021-07-21 | | Last modified: | 2024-11-20 | | Method: | X-RAY DIFFRACTION (2.095 Å) | | Cite: | Glycoside hydrolase family 5: structural snapshots highlighting the involvement of two conserved residues in catalysis.
Acta Crystallogr D Struct Biol, 77, 2021
|
|
