PDB: 72678 resultsInfo pagesStatus searchChemie searchBIRD

---

6XKI	Crystal structure of eIF4A-I in complex with RNA bound to des-MePateA, a pateamine A analog Descriptor: (3S,6Z,8E,11S,15R)-15-amino-3-[(1E,3E,5E)-7-(dimethylamino)-2,5-dimethylhepta-1,3,5-trien-1-yl]-9,11-dimethyl-4,12-dioxa-20-thia-21-azabicyclo[16.2.1]henicosa-1(21),6,8,18-tetraene-5,13-dione, Eukaryotic initiation factor 4A-I, MAGNESIUM ION, ... Authors: Liang, J, Naineni, S.K, Pelletier, J, Nagar, B. Deposit date: 2020-06-26 Release date: 2021-01-06 Last modified: 2023-10-18 Method: X-RAY DIFFRACTION (2.87 Å) Cite: Functional mimicry revealed by the crystal structure of an eIF4A:RNA complex bound to the interfacial inhibitor, desmethyl pateamine A. Cell Chem Biol, 28, 2021
6W1X	Cryo-EM structure of anti-CRISPR AcrIF9, bound to the type I-F crRNA-guided CRISPR surveillance complex Descriptor: CRISPR-associated endonuclease Cas6/Csy4, CRISPR-associated protein Csy1, CRISPR-associated protein Csy3, ... Authors: Hirschi, M, Santiago-Frangos, A, Wilkinson, R, Golden, S.M, Wiedenheft, B, Lander, G. Deposit date: 2020-03-04 Release date: 2020-05-13 Last modified: 2024-03-06 Method: ELECTRON MICROSCOPY (3.9 Å) Cite: AcrIF9 tethers non-sequence specific dsDNA to the CRISPR RNA-guided surveillance complex. Nat Commun, 11, 2020
2G8F	B. halodurans RNase H catalytic domain E188A mutant in complex with Mg2+ and RNA/DNA hybrid (non-P nick at the active site) Descriptor: 5'-D(*AP*TP*GP*TP*CP*G)-3', 5'-R(*UP*CP*GP*AP*CP*A)-3', CHLORIDE ION, ... Authors: Nowotny, M, Yang, W. Deposit date: 2006-03-02 Release date: 2006-04-25 Last modified: 2023-08-30 Method: X-RAY DIFFRACTION (1.65 Å) Cite: Stepwise analyses of metal ions in RNase H catalysis from substrate destabilization to product release. Embo J., 25, 2006
2G8U	B. halodurans RNase H catalytic domain D132N mutant in complex with Mg2+ and RNA/DNA hybrid (non-P nick at the active site) Descriptor: 5'-D(*AP*TP*GP*TP*CP*G)-3', 5'-R(*UP*CP*GP*AP*CP*A)-3', MAGNESIUM ION, ... Authors: Nowotny, M, Yang, W. Deposit date: 2006-03-03 Release date: 2006-04-25 Last modified: 2023-08-30 Method: X-RAY DIFFRACTION (2.7 Å) Cite: Stepwise analyses of metal ions in RNase H catalysis from substrate destabilization to product release. Embo J., 25, 2006
4FLA	Crystal structure of human RPRD1B, carboxy-terminal domain Descriptor: Regulation of nuclear pre-mRNA domain-containing protein 1B, UNKNOWN ATOM OR ION Authors: Ni, Z, Xu, C, Tempel, W, El Bakkouri, M, Loppnau, P, Guo, X, Bountra, C, Arrowsmith, C.H, Edwards, A.M, Min, J, Greenblatt, J.F, Structural Genomics Consortium (SGC) Deposit date: 2012-06-14 Release date: 2012-08-22 Last modified: 2024-02-28 Method: X-RAY DIFFRACTION (2.2 Å) Cite: RPRD1A and RPRD1B are human RNA polymerase II C-terminal domain scaffolds for Ser5 dephosphorylation. Nat.Struct.Mol.Biol., 21, 2014
7XSO	Structure of the type III-E CRISPR-Cas effector gRAMP Descriptor: RAMP superfamily protein, RNA (35-MER), ZINC ION Authors: Feng, Y, Zhang, L. Deposit date: 2022-05-15 Release date: 2023-03-22 Last modified: 2024-07-03 Method: ELECTRON MICROSCOPY (3.01 Å) Cite: Target RNA activates the protease activity of Craspase to confer antiviral defense. Mol.Cell, 82, 2022
2G8K	B. halodurans RNase H catalytic domain D192N mutant in complex with Ca2+ and RNA/DNA hybrid (non-P nick at the active site) Descriptor: 5'-D(*AP*TP*GP*TP*CP*G)-3', 5'-R(*UP*CP*GP*AP*CP*A)-3', CALCIUM ION, ... Authors: Nowotny, M, Yang, W. Deposit date: 2006-03-02 Release date: 2006-04-25 Last modified: 2023-08-30 Method: X-RAY DIFFRACTION (1.65 Å) Cite: Stepwise analyses of metal ions in RNase H catalysis from substrate destabilization to product release. Embo J., 25, 2006
2G8V	B. halodurans RNase H catalytic domain E188A mutant in complex with Mg2+ and RNA/DNA hybrid (reaction product) Descriptor: 5'-D(*AP*TP*GP*TP*CP*G)-3', 5'-R(P*UP*CP*GP*AP*CP*A)-3', ETHANOL, ... Authors: Nowotny, M, Yang, W. Deposit date: 2006-03-03 Release date: 2006-04-25 Last modified: 2023-08-30 Method: X-RAY DIFFRACTION (1.85 Å) Cite: Stepwise analyses of metal ions in RNase H catalysis from substrate destabilization to product release. Embo J., 25, 2006
1UVJ	The structural basis for RNA specificity and Ca2 inhibition of an RNA-dependent RNA polymerase phi6p2 with 7nt RNA Descriptor: 5'-R(*UP*UP*CP*CP)-3', MANGANESE (II) ION, RNA-directed RNA polymerase Authors: Salgado, P.S, Makeyev, E.V, Butcher, S, Bamford, D, Stuart, D.I, Grimes, J.M. Deposit date: 2004-01-21 Release date: 2004-02-19 Last modified: 2023-12-13 Method: X-RAY DIFFRACTION (1.9 Å) Cite: The structural basis for RNA specificity and Ca2+ inhibition of an RNA-dependent RNA polymerase. Structure, 12, 2004
2G8H	B. halodurans RNase H catalytic domain D192N mutant in complex with Mg2+ and RNA/DNA hybrid (non-P nick at the active site) Descriptor: 5'-D(*AP*TP*GP*TP*CP*G)-3', 5'-R(*UP*CP*GP*AP*CP*A)-3', MAGNESIUM ION, ... Authors: Nowotny, M, Yang, W. Deposit date: 2006-03-02 Release date: 2006-04-25 Last modified: 2023-08-30 Method: X-RAY DIFFRACTION (1.85 Å) Cite: Stepwise analyses of metal ions in RNase H catalysis from substrate destabilization to product release. Embo J., 25, 2006
1ZE2	Conformational change of pseudouridine 55 synthase upon its association with RNA substrate Descriptor: 5'-R(*GP*GP*CP*CP*AP*CP*GP*GP*UP*(FHU)P*CP*GP*AP*AP*UP*CP*CP*GP*UP*GP*GP*C)-3', tRNA pseudouridine synthase B Authors: Phannachet, K, Huang, R.H. Deposit date: 2005-04-16 Release date: 2005-04-26 Last modified: 2024-02-14 Method: X-RAY DIFFRACTION (3 Å) Cite: Conformational change of pseudouridine 55 synthase upon its association with RNA substrate Nucleic Acids Res., 32, 2004
1UVM	The structural basis for RNA specificity and Ca2 inhibition of an RNA-dependent RNA polymerase phi6p2 with 5NT RNA conformation A Descriptor: 5'-R(*UP*UP*UP*CP*CP)-3', MANGANESE (II) ION, RNA-directed RNA polymerase Authors: Salgado, P.S, Makeyev, E.V, Butcher, S, Bamford, D, Stuart, D.I, Grimes, J.M. Deposit date: 2004-01-21 Release date: 2004-02-19 Last modified: 2023-12-13 Method: X-RAY DIFFRACTION (2 Å) Cite: The structural basis for RNA specificity and Ca2+ inhibition of an RNA-dependent RNA polymerase. Structure, 12, 2004
1MWL	Crystal structure of geneticin bound to the eubacterial 16S rRNA A site Descriptor: 5'-R(*CP*GP*CP*GP*UP*CP*AP*CP*AP*CP*CP*GP*GP*UP*GP*AP*AP*GP*UP*CP*GP*C)-3', GENETICIN Authors: Vicens, Q, Westhof, E. Deposit date: 2002-09-30 Release date: 2003-02-18 Last modified: 2024-02-14 Method: X-RAY DIFFRACTION (2.4 Å) Cite: Crystal structure of geneticin bound to a bacterial 16S ribosomal RNA A site oligonucleotide J.Mol.Biol., 326, 2003
6PZQ	Structure of the human respiratory syncytial virus M2-1 protein in complex with a short positive-sense gene-end RNA Descriptor: Matrix M2-1, RNA (5'-R(P*GP*UP*UP*AP*AP*U)-3'), ZINC ION Authors: Gao, Y, Cao, D, Liang, B. Deposit date: 2019-08-01 Release date: 2020-08-05 Last modified: 2023-10-11 Method: X-RAY DIFFRACTION (2.703 Å) Cite: Structure of the Human Respiratory Syncytial Virus M2-1 Protein in Complex with a Short Positive-Sense Gene-End RNA. Structure, 28, 2020
6TFH	Crystal structure of the ADP-binding domain of the NAD+ riboswitch with Nicotinamide adenine dinucleotide, reduced (NADH); soaking with Manganese(II) (Mn2+) Descriptor: Chains: A, MANGANESE (II) ION, NICOTINAMIDE-ADENINE-DINUCLEOTIDE, ... Authors: Huang, L, Lilley, D.M.J. Deposit date: 2019-11-14 Release date: 2020-09-23 Last modified: 2024-01-24 Method: X-RAY DIFFRACTION (2.95 Å) Cite: Structure and ligand binding of the ADP-binding domain of the NAD+ riboswitch. Rna, 26, 2020
3LJ1	IRE1 complexed with Cdk1/2 Inhibitor III Descriptor: 5-AMINO-3-{[4-(AMINOSULFONYL)PHENYL]AMINO}-N-(2,6-DIFLUOROPHENYL)-1H-1,2,4-TRIAZOLE-1-CARBOTHIOAMIDE, Serine/threonine-protein kinase/endoribonuclease IRE1 Authors: Lee, K.P.K, Sicheri, F. Deposit date: 2010-01-25 Release date: 2010-05-12 Last modified: 2023-09-06 Method: X-RAY DIFFRACTION (3.33 Å) Cite: Flavonol activation defines an unanticipated ligand-binding site in the kinase-RNase domain of IRE1. Mol.Cell, 38, 2010
3LJ0	IRE1 complexed with ADP and Quercetin Descriptor: 3,5,7,3',4'-PENTAHYDROXYFLAVONE, ADENOSINE-5'-DIPHOSPHATE, MAGNESIUM ION, ... Authors: Lee, K.P.K, Sicheri, F. Deposit date: 2010-01-25 Release date: 2010-05-12 Last modified: 2023-09-06 Method: X-RAY DIFFRACTION (3.2 Å) Cite: Flavonol activation defines an unanticipated ligand-binding site in the kinase-RNase domain of IRE1. Mol.Cell, 38, 2010
8GWF	A mechanism for SARS-CoV-2 RNA capping and its inhibition by nucleotide analogue inhibitors Descriptor: GUANOSINE-5'-TRIPHOSPHATE, Helicase, Non-structural protein 7, ... Authors: Yan, L.Y, Huang, Y.C, Rao, Z.H, Lou, Z.Y. Deposit date: 2022-09-17 Release date: 2023-01-11 Last modified: 2024-07-03 Method: ELECTRON MICROSCOPY (3.39 Å) Cite: A mechanism for SARS-CoV-2 RNA capping and its inhibition by nucleotide analog inhibitors. Cell, 185, 2022
6RA4	Human ARGONAUTE-2 PAZ DOMAIN (214-347) IN COMPLEX WITH CGUGACUCU Descriptor: GLYCEROL, Protein argonaute-2, RNA (5'-R(*CP*GP*UP*GP*AP*CP*UP*CP*U)-3') Authors: Rondeau, J.-M, Bourgier, E. Deposit date: 2019-04-05 Release date: 2019-05-08 Last modified: 2024-05-15 Method: X-RAY DIFFRACTION (1.9 Å) Cite: How to Computationally Stack the Deck for Hit-to-Lead Generation: In Silico Molecular Interaction Energy Profiling for de Novo siRNA Guide Strand Surrogate Selection. J.Chem.Inf.Model., 59, 2019
2I2Y	Solution structure of the RRM of SRp20 bound to the RNA CAUC Descriptor: (5'-R(*CP*AP*UP*C)-3'), Fusion protein consists of immunoglobulin G-Binding Protein G and Splicing factor, arginine/serine-rich 3 Authors: Hargous, Y.F, Allain, F.H. Deposit date: 2006-08-17 Release date: 2006-12-12 Last modified: 2024-05-29 Method: SOLUTION NMR Cite: Molecular basis of RNA recognition and TAP binding by the SR proteins SRp20 and 9G8. Embo J., 25, 2006
6TFG	Crystal structure of the ADP-binding domain of the NAD+ riboswitch with Adenosine 3-phosphate 5-phosphosulfate (APPS) Descriptor: 3'-PHOSPHATE-ADENOSINE-5'-PHOSPHATE SULFATE, Chains: A, MAGNESIUM ION, ... Authors: Huang, L, Lilley, D.M.J. Deposit date: 2019-11-14 Release date: 2020-09-23 Last modified: 2024-01-24 Method: X-RAY DIFFRACTION (2.45 Å) Cite: Structure and ligand binding of the ADP-binding domain of the NAD+ riboswitch. Rna, 26, 2020
3QX8	Crystal structure of MID domain from hAGO2 in complex with m7GpppG Descriptor: 7-METHYL-GUANOSINE-5'-TRIPHOSPHATE-5'-GUANOSINE, Protein argonaute-2 Authors: Frank, F, Fabian, M.R, Stepinski, J, Jemielity, J, Darzynkiewicz, E, Sonenberg, N, Nagar, B. Deposit date: 2011-03-01 Release date: 2011-04-20 Last modified: 2023-09-13 Method: X-RAY DIFFRACTION (2.3 Å) Cite: Structural analysis of 5'-mRNA-cap interactions with the human AGO2 MID domain. Embo Rep., 12, 2011
4ZT0	Crystal structure of catalytically-active Streptococcus pyogenes Cas9 in complex with single-guide RNA at 2.9 Angstrom resolution Descriptor: CRISPR-associated endonuclease Cas9, single-guide RNA Authors: Jiang, F, Doudna, J.A. Deposit date: 2015-05-14 Release date: 2015-07-08 Method: X-RAY DIFFRACTION (2.9 Å) Cite: A Cas9-guide RNA complex preorganized for target DNA recognition. Science, 348, 2015
3LJ2	IRE1 complexed with JAK Inhibitor I Descriptor: 2-TERT-BUTYL-9-FLUORO-3,6-DIHYDRO-7H-BENZ[H]-IMIDAZ[4,5-F]ISOQUINOLINE-7-ONE, Serine/threonine-protein kinase/endoribonuclease IRE1 Authors: Lee, K.P.K, Sicheri, F. Deposit date: 2010-01-25 Release date: 2010-05-12 Last modified: 2023-09-06 Method: X-RAY DIFFRACTION (3.33 Å) Cite: Flavonol activation defines an unanticipated ligand-binding site in the kinase-RNase domain of IRE1. Mol.Cell, 38, 2010
1QWA	NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12. Descriptor: 18S ribosomal RNA, 5'ETS Authors: Finger, L.D, Trantirek, L, Johansson, C, Feigon, J. Deposit date: 2003-09-01 Release date: 2003-11-25 Last modified: 2024-05-01 Method: SOLUTION NMR Cite: Solution Strucutres of Stem-loop RNAs that Bind to the Two N-terminal RNA Binding Domains of Nucleolin Nucleic Acids Res., 31, 2003

<193194195196197198199200201202203204205206207208>