2QQB
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2qqb by Molmil](/molmil-images/mine/2qqb) | Crystal Structure of DtxR(M10A C102D) Complexed with Nickel(II) | Descriptor: | Diphtheria toxin repressor, NICKEL (II) ION, PHOSPHATE ION | Authors: | D'Aquino, J.A, Lattimer, J.R, Denninger, A, D'Aquino, K.E, Ringe, D. | Deposit date: | 2007-07-26 | Release date: | 2007-10-30 | Last modified: | 2023-08-30 | Method: | X-RAY DIFFRACTION (1.92 Å) | Cite: | Role of the N-Terminal Helix in the Metal Ion-Induced Activation of the Diphtheria Toxin Repressor DtxR. Biochemistry, 46, 2007
|
|
2QQA
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2qqa by Molmil](/molmil-images/mine/2qqa) | Crystal Structure of DtxR(E9A C102D) Complexed with Nickel(II) | Descriptor: | Diphtheria toxin repressor, NICKEL (II) ION, PHOSPHATE ION | Authors: | D'Aquino, J.A, Lattimer, J.R, Denninger, A, D'Aquino, K.E, Ringe, D. | Deposit date: | 2007-07-26 | Release date: | 2007-10-30 | Last modified: | 2023-08-30 | Method: | X-RAY DIFFRACTION (2.1 Å) | Cite: | Role of the N-Terminal Helix in the Metal Ion-Induced Activation of the Diphtheria Toxin Repressor DtxR. Biochemistry, 46, 2007
|
|
2P1Q
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2p1q by Molmil](/molmil-images/mine/2p1q) | Mechanism of Auxin Perception by the TIR1 ubiquitin ligase | Descriptor: | 1H-INDOL-3-YLACETIC ACID, Auxin-responsive protein IAA7, INOSITOL HEXAKISPHOSPHATE, ... | Authors: | Tan, X, Calderon-Villalobos, L.I.A, Sharon, M, Robinson, C.V, Estelle, M, Zheng, N. | Deposit date: | 2007-03-06 | Release date: | 2007-04-10 | Last modified: | 2023-08-30 | Method: | X-RAY DIFFRACTION (1.91 Å) | Cite: | Mechanism of auxin perception by the TIR1 ubiquitin ligase. Nature, 446, 2007
|
|
6UVU
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6uvu by Molmil](/molmil-images/mine/6uvu) | Crystal structure of the AntR antimony-specific transcriptional repressor | Descriptor: | ArsR family transcriptional regulator | Authors: | Thiruselvam, V, Banumathi, S, Palani, K, Manohar, R, Rosen, B.P. | Deposit date: | 2019-11-04 | Release date: | 2020-11-04 | Last modified: | 2023-10-11 | Method: | X-RAY DIFFRACTION (2.1 Å) | Cite: | Functional and structural characterization of AntR, an Sb(III) responsive transcriptional repressor. Mol.Microbiol., 116, 2021
|
|
6FAL
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6fal by Molmil](/molmil-images/mine/6fal) | |
6F7F
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6f7f by Molmil](/molmil-images/mine/6f7f) | |
6F7G
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6f7g by Molmil](/molmil-images/mine/6f7g) | |
6F9K
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6f9k by Molmil](/molmil-images/mine/6f9k) | |
5JLU
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5jlu by Molmil](/molmil-images/mine/5jlu) | |
6WMQ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6wmq by Molmil](/molmil-images/mine/6wmq) | |
3N00
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3n00 by Molmil](/molmil-images/mine/3n00) | |
1UI5
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1ui5 by Molmil](/molmil-images/mine/1ui5) | |
3MI7
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3mi7 by Molmil](/molmil-images/mine/3mi7) | An Enhanced Repressor of Human Papillomavirus E2 Protein | Descriptor: | 1,2-ETHANEDIOL, Regulatory protein E2 | Authors: | Bohm, A, Baleja, J, Bose, K, Meinke, G. | Deposit date: | 2010-04-09 | Release date: | 2011-04-06 | Last modified: | 2023-09-06 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | Design and characterization of an enhanced repressor of human papillomavirus E2 protein. Faseb J., 25, 2011
|
|
6CBQ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6cbq by Molmil](/molmil-images/mine/6cbq) | Crystal structure of QscR bound to agonist S3 | Descriptor: | (2S)-2-hexyl-N-[(3S)-2-oxooxolan-3-yl]decanamide, LuxR family transcriptional regulator | Authors: | Churchill, M.E.A, Wysoczynski-Horita, C.L. | Deposit date: | 2018-02-05 | Release date: | 2018-02-28 | Last modified: | 2023-10-04 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | Mechanism of agonism and antagonism of the Pseudomonas aeruginosa quorum sensing regulator QscR with non-native ligands. Mol. Microbiol., 108, 2018
|
|
6RNX
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6rnx by Molmil](/molmil-images/mine/6rnx) | Crystal structure of the essential repressor DdrO from radiation-resistant Deinococcus bacteria (Deinococcus deserti) | Descriptor: | CHLORIDE ION, HTH-type transcriptional regulator DdrOC | Authors: | Arnoux, P, Siponen, M.I, Pignol, D, De Groot, A, Blanchard, L. | Deposit date: | 2019-05-09 | Release date: | 2019-10-09 | Last modified: | 2024-01-24 | Method: | X-RAY DIFFRACTION (2.84 Å) | Cite: | Crystal structure of the transcriptional repressor DdrO: insight into the metalloprotease/repressor-controlled radiation response in Deinococcus. Nucleic Acids Res., 47, 2019
|
|
6C9T
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6c9t by Molmil](/molmil-images/mine/6c9t) | Transcriptional repressor, CouR | Descriptor: | CouR | Authors: | Cogan, D.P, Nair, S.K. | Deposit date: | 2018-01-28 | Release date: | 2018-05-30 | Last modified: | 2023-10-04 | Method: | X-RAY DIFFRACTION (2.07 Å) | Cite: | Structural basis of transcriptional regulation by CouR, a repressor of coumarate catabolism, inRhodopseudomonas palustris. J. Biol. Chem., 293, 2018
|
|
6C28
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6c28 by Molmil](/molmil-images/mine/6c28) | Transcriptional repressor, CouR, bound to p-coumaroyl-CoA | Descriptor: | Transcriptional regulator, MarR family, p-coumaroyl-CoA | Authors: | Cogan, D.P, Nair, S.K. | Deposit date: | 2018-01-07 | Release date: | 2018-05-30 | Last modified: | 2024-03-13 | Method: | X-RAY DIFFRACTION (2.09 Å) | Cite: | Structural basis of transcriptional regulation by CouR, a repressor of coumarate catabolism, inRhodopseudomonas palustris. J. Biol. Chem., 293, 2018
|
|
5CW8
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5cw8 by Molmil](/molmil-images/mine/5cw8) | Crystal structure of Mycobacterium tuberculosis KstR in complex with 3-oxo-4-cholesten-26-oyl-CoA | Descriptor: | HTH-type transcriptional repressor KstR, S-{1-[5-(6-amino-9H-purin-9-yl)-4-hydroxy-3-(phosphonooxy)tetrahydrofuran-2-yl]-3,7-dihydroxy-6,6-dimethyl-3-oxido-8,12 -dioxo-2,4-dioxa-9,13-diaza-3lambda~5~-phosphapentadecan-15-yl} (2S,6R)-6-[(8S,9S,10R,13R,14S,17R)-10,13-dimethyl-3-oxo-2,3,6,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta [a]phenanthren-17-yl]-2-methylheptanethioate (non-preferred name), TRIETHYLENE GLYCOL | Authors: | Ho, N.A.T, Dawes, S, Kendall, S, Casabon, I, Crowe, A.M, Baker, E.N, Eltis, L.D, Lott, J.S, TB Structural Genomics Consortium (TBSGC) | Deposit date: | 2015-07-27 | Release date: | 2016-02-17 | Last modified: | 2023-09-27 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | The Structure of the Transcriptional Repressor KstR in Complex with CoA Thioester Cholesterol Metabolites Sheds Light on the Regulation of Cholesterol Catabolism in Mycobacterium tuberculosis. J.Biol.Chem., 291, 2016
|
|
5CXG
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5cxg by Molmil](/molmil-images/mine/5cxg) | Crystal structure of Mycobacterium tuberculosis KstR in complex with PEG | Descriptor: | DI(HYDROXYETHYL)ETHER, HTH-type transcriptional repressor KstR, TRIETHYLENE GLYCOL | Authors: | Ho, N.A.T, Dawes, S, Kendall, S, Baker, E.N, Lott, J.S, TB Structural Genomics Consortium (TBSGC) | Deposit date: | 2015-07-28 | Release date: | 2016-02-17 | Last modified: | 2023-09-27 | Method: | X-RAY DIFFRACTION (2.1001 Å) | Cite: | The Structure of the Transcriptional Repressor KstR in Complex with CoA Thioester Cholesterol Metabolites Sheds Light on the Regulation of Cholesterol Catabolism in Mycobacterium tuberculosis. J.Biol.Chem., 291, 2016
|
|
6RGX
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6rgx by Molmil](/molmil-images/mine/6rgx) | TETR(D) N82A MUTANT IN COMPLEX WITH DOXYCYCLINE AND MAGNESIUM | Descriptor: | (4S,4AR,5S,5AR,6R,12AS)-4-(DIMETHYLAMINO)-3,5,10,12,12A-PENTAHYDROXY-6-METHYL-1,11-DIOXO-1,4,4A,5,5A,6,11,12A-OCTAHYDROTETRACENE-2-CARBOXAMIDE, CHLORIDE ION, MAGNESIUM ION, ... | Authors: | Hinrichs, W, Palm, G.J, Berndt, L, Girbardt, B. | Deposit date: | 2019-04-17 | Release date: | 2019-08-21 | Last modified: | 2024-01-24 | Method: | X-RAY DIFFRACTION (1.8 Å) | Cite: | Thermodynamics, cooperativity and stability of the tetracycline repressor (TetR) upon tetracycline binding. Biochim Biophys Acta Proteins Proteom, 1868, 2020
|
|
1SAX
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1sax by Molmil](/molmil-images/mine/1sax) | Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA | Descriptor: | 5'-d(CAAAATTACAACTGTAATATCGGAG)-3', 5'-d(GCTCCGATATTACAGTTGTAATTTT)-3', Methicillin resistance regulatory protein mecI, ... | Authors: | Garcia-Castellanos, R, Mallorqui-Fernandez, G, Marrero, A, Potempa, J, Coll, M, Gomis-Ruth, F.X. | Deposit date: | 2004-02-09 | Release date: | 2004-04-27 | Last modified: | 2023-08-23 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | On the transcriptional regulation of methicillin resistance: MecI repressor in complex with its operator J.Biol.Chem., 279, 2004
|
|
5CXI
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5cxi by Molmil](/molmil-images/mine/5cxi) | Crystal structure of Mycobacterium tuberculosis KstR in complex with 3-oxo-23,24-bisnorchol-4-en-22-oyl-CoA (4-BNC-CoA) | Descriptor: | 3-oxo-23,24-bisnorchol-4-en-22-oyl-CoA, HTH-type transcriptional repressor KstR | Authors: | Ho, N.A.T, Dawes, S, Kendall, S, Casabon, I, Crowe, A.M, Baker, E.N, Eltis, L.D, Lott, J.S, TB Structural Genomics Consortium (TBSGC) | Deposit date: | 2015-07-29 | Release date: | 2016-02-17 | Last modified: | 2024-03-06 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | The Structure of the Transcriptional Repressor KstR in Complex with CoA Thioester Cholesterol Metabolites Sheds Light on the Regulation of Cholesterol Catabolism in Mycobacterium tuberculosis. J.Biol.Chem., 291, 2016
|
|
5D4S
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5d4s by Molmil](/molmil-images/mine/5d4s) | Crystal Structure of AraR(DBD) in complex with operator ORX1 | Descriptor: | Arabinose metabolism transcriptional repressor, DNA (5'-D(*AP*AP*AP*TP*AP*CP*AP*TP*AP*CP*GP*TP*AP*CP*AP*AP*AP*TP*AP*TP*T)-3'), DNA (5'-D(*TP*AP*AP*TP*AP*TP*TP*TP*GP*TP*AP*CP*GP*TP*AP*TP*GP*TP*AP*TP*T)-3') | Authors: | Jain, D, Narayanan, N, Nair, D.T. | Deposit date: | 2015-08-08 | Release date: | 2015-11-04 | Last modified: | 2023-11-08 | Method: | X-RAY DIFFRACTION (1.972 Å) | Cite: | Plasticity in Repressor-DNA Interactions Neutralizes Loss of Symmetry in Bipartite Operators. J.Biol.Chem., 291, 2016
|
|
5D4R
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5d4r by Molmil](/molmil-images/mine/5d4r) | Crystal Structure of AraR(DBD) in complex with operator ORE1 | Descriptor: | Arabinose metabolism transcriptional repressor, DNA (5'-D(*AP*TP*AP*TP*TP*TP*GP*TP*AP*CP*GP*TP*AP*CP*TP*AP*AP*TP*TP*AP*T)-3'), DNA (5'-D(*TP*AP*TP*AP*AP*TP*TP*AP*GP*TP*AP*CP*GP*TP*AP*CP*AP*AP*AP*TP*A)-3') | Authors: | Jain, D, Narayanan, N, Nair, D.T. | Deposit date: | 2015-08-08 | Release date: | 2015-11-04 | Last modified: | 2023-11-08 | Method: | X-RAY DIFFRACTION (2.07 Å) | Cite: | Plasticity in Repressor-DNA Interactions Neutralizes Loss of Symmetry in Bipartite Operators. J.Biol.Chem., 291, 2016
|
|
5E24
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5e24 by Molmil](/molmil-images/mine/5e24) | Structure of the Su(H)-Hairless-DNA Repressor Complex | Descriptor: | 1,2-ETHANEDIOL, DNA (5'-D(*AP*AP*TP*CP*TP*TP*TP*CP*CP*CP*AP*CP*AP*GP*T)-3'), DNA (5'-D(*TP*TP*AP*CP*TP*GP*TP*GP*GP*GP*AP*AP*AP*GP*A)-3'), ... | Authors: | Kovall, R.A, Yuan, Z. | Deposit date: | 2015-09-30 | Release date: | 2016-06-15 | Last modified: | 2023-09-27 | Method: | X-RAY DIFFRACTION (2.14 Å) | Cite: | Structure and Function of the Su(H)-Hairless Repressor Complex, the Major Antagonist of Notch Signaling in Drosophila melanogaster. Plos Biol., 14, 2016
|
|