6ENL
| |
3HRR
| The Product Template Domain from PksA with Harris Compound Bound | Descriptor: | 1-(3-acetyl-4,5-dihydroxy-7-methoxynaphthalen-2-yl)propan-2-one, Aflatoxin biosynthesis polyketide synthase | Authors: | Korman, T.P, Tsai, S.C. | Deposit date: | 2009-06-09 | Release date: | 2009-10-20 | Last modified: | 2023-09-06 | Method: | X-RAY DIFFRACTION (1.9 Å) | Cite: | Structural basis for biosynthetic programming of fungal aromatic polyketide cyclization. Nature, 461, 2009
|
|
3U94
| |
6U5W
| |
2PWG
| Crystal Structure of the Trehalulose Synthase MutB From Pseudomonas Mesoacidophila MX-45 Complexed to the Inhibitor Castanospermine | Descriptor: | CALCIUM ION, CASTANOSPERMINE, Sucrose isomerase | Authors: | Ravaud, S, Robert, X, Haser, R, Aghajari, N. | Deposit date: | 2007-05-11 | Release date: | 2007-06-26 | Last modified: | 2023-08-30 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | Trehalulose synthase native and carbohydrate complexed structures provide insights into sucrose isomerization. J.Biol.Chem., 61, 2007
|
|
6U7O
| HIV-1 wild type protease with GRL-00819A, with phenyl-boronic-acid as P2'-ligand and with a 6-5-5-ring fused crown-like tetrahydropyranofuran as the P2-ligand | Descriptor: | CHLORIDE ION, FORMIC ACID, GLYCEROL, ... | Authors: | Wang, Y.-F, Kneller, D.W, Weber, I.T. | Deposit date: | 2019-09-03 | Release date: | 2019-10-09 | Last modified: | 2023-10-11 | Method: | X-RAY DIFFRACTION (1.33 Å) | Cite: | Potent HIV-1 Protease Inhibitors Containing Carboxylic and Boronic Acids: Effect on Enzyme Inhibition and Antiviral Activity and Protein-Ligand X-ray Structural Studies. Chemmedchem, 14, 2019
|
|
6ZMD
| Crystal structure of HYPE covalently tethered to BiP bound to AMP-PNP | Descriptor: | Endoplasmic reticulum chaperone BiP, MAGNESIUM ION, PHOSPHATE ION, ... | Authors: | Fauser, J, Gulen, B, Pett, C, Hedberg, C, Itzen, A, Pogenberg, V. | Deposit date: | 2020-07-02 | Release date: | 2021-04-14 | Last modified: | 2024-01-31 | Method: | X-RAY DIFFRACTION (2.64 Å) | Cite: | Specificity of AMPylation of the human chaperone BiP is mediated by TPR motifs of FICD. Nat Commun, 12, 2021
|
|
3U93
| |
5HHO
| Crystal Structure of the JM22 TCR in complex with HLA-A*0201 in complex with M1-G4E | Descriptor: | Beta-2-microglobulin, HLA class I histocompatibility antigen, A-2 alpha chain, ... | Authors: | Gras, S, Josephs, T.M, Rossjohn, J. | Deposit date: | 2016-01-11 | Release date: | 2016-03-23 | Last modified: | 2023-09-27 | Method: | X-RAY DIFFRACTION (2.95 Å) | Cite: | Molecular basis for universal HLA-A*0201-restricted CD8+ T-cell immunity against influenza viruses. Proc.Natl.Acad.Sci.USA, 113, 2016
|
|
2KW2
| Solution NMR of the specialized acyl carrier protein (RPA2022) from Rhodopseudomonas palustris, Northeast Structural Genomics Consortium Target RpR324 | Descriptor: | Specialized acyl carrier protein | Authors: | Rossi, P, Lee, H, Wohlbold, T.J, Valafar, H, Lemak, A, Ertekin, A, Forouhar, F, Ciccosanti, C, Rost, B, Acton, T, Xiao, R, Everett, J, Montelione, G.T, Northeast Structural Genomics Consortium (NESG) | Deposit date: | 2010-03-30 | Release date: | 2010-04-21 | Last modified: | 2024-05-01 | Method: | SOLUTION NMR | Cite: | Structure of a specialized acyl carrier protein essential for lipid A biosynthesis with very long-chain fatty acids in open and closed conformations. Biochemistry, 51, 2012
|
|
3L2Q
| Crystal structure of the Prototype Foamy Virus (PFV) intasome in apo form | Descriptor: | 5'-D(*AP*TP*TP*GP*TP*CP*AP*TP*GP*GP*AP*AP*TP*TP*TP*TP*GP*TP*A)-3', 5'-D(*TP*AP*CP*AP*AP*AP*AP*TP*TP*CP*CP*AP*TP*GP*AP*CP*A)-3', GLYCEROL, ... | Authors: | Hare, S, Gupta, S.S, Cherepanov, P. | Deposit date: | 2009-12-15 | Release date: | 2010-02-09 | Last modified: | 2023-11-01 | Method: | X-RAY DIFFRACTION (3.25 Å) | Cite: | Retroviral intasome assembly and inhibition of DNA strand transfer Nature, 464, 2010
|
|
5XPT
| |
3KMQ
| G62S mutant of foot-and-mouth disease virus RNA-polymerase in complex with a template- primer RNA, tetragonal structure | Descriptor: | 3D polymerase, RNA (5'-R(*GP*GP*CP*CP*C)-3'), RNA (5'-R(P*GP*GP*GP*CP*C)-3') | Authors: | Ferrer-Orta, C, Verdaguer, N, Perez-Luque, R. | Deposit date: | 2009-11-11 | Release date: | 2010-07-07 | Last modified: | 2023-11-01 | Method: | X-RAY DIFFRACTION (2.11 Å) | Cite: | Structure of foot-and-mouth disease virus mutant polymerases with reduced sensitivity to ribavirin J.Virol., 84, 2010
|
|
6UG7
| Complex of ch28/11 Fab and SSEA-4 (tetragonal form) | Descriptor: | 1,2-ETHANEDIOL, N-acetyl-alpha-neuraminic acid-(2-3)-beta-D-galactopyranose-(1-3)-2-acetamido-2-deoxy-beta-D-galactopyranose-(1-3)-alpha-D-galactopyranose-(1-4)-beta-D-galactopyranose-(1-4)-beta-D-glucopyranose, SULFATE ION, ... | Authors: | Soliman, C, Ramsland, P.A. | Deposit date: | 2019-09-26 | Release date: | 2019-12-18 | Last modified: | 2023-10-11 | Method: | X-RAY DIFFRACTION (1.52 Å) | Cite: | The terminal sialic acid of stage-specific embryonic antigen-4 has a crucial role in binding to a cancer-targeting antibody. J.Biol.Chem., 295, 2020
|
|
3L2U
| Crystal structure of the Prototype Foamy Virus (PFV) intasome in complex with magnesium and GS9137 (Elvitegravir) | Descriptor: | 5'-D(*AP*TP*TP*GP*TP*CP*AP*TP*GP*GP*AP*AP*TP*TP*TP*TP*GP*TP*A)-3', 5'-D(*TP*AP*CP*AP*AP*AP*AP*TP*TP*CP*CP*AP*TP*GP*AP*CP*A)-3', 6-(3-chloro-2-fluorobenzyl)-1-[(1S)-1-(hydroxymethyl)-2-methylpropyl]-7-methoxy-4-oxo-1,4-dihydroquinoline-3-carboxylic acid, ... | Authors: | Hare, S, Gupta, S.S, Cherepanov, P. | Deposit date: | 2009-12-15 | Release date: | 2010-02-09 | Last modified: | 2023-11-01 | Method: | X-RAY DIFFRACTION (3.15 Å) | Cite: | Retroviral intasome assembly and inhibition of DNA strand transfer Nature, 464, 2010
|
|
3SY8
| Crystal structure of the response regulator RocR | Descriptor: | 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID, MAGNESIUM ION, RocR | Authors: | Chen, M.W, Kotaka, M, Vonrhein, C, Bricogne, G, Lescar, J. | Deposit date: | 2011-07-16 | Release date: | 2012-07-18 | Last modified: | 2024-03-20 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | Structural insights into the regulatory mechanism of the response regulator RocR from Pseudomonas aeruginosa in cyclic Di-GMP signaling. J.Bacteriol., 194, 2012
|
|
6L40
| Discovery of novel peptidomimetic boronate ClpP inhibitors with noncanonical enzyme mechanism as potent virulence blockers in vitro and in vivo | Descriptor: | ATP-dependent Clp protease proteolytic subunit, [(1S)-3-methyl-1-[[(2S)-3-phenyl-2-(pyrazin-2-ylcarbonylamino)propanoyl]amino]butyl]boronic acid | Authors: | Luo, Y.F, Bao, R, Ju, Y, He, L.H. | Deposit date: | 2019-10-15 | Release date: | 2020-07-08 | Last modified: | 2023-11-22 | Method: | X-RAY DIFFRACTION (2.209 Å) | Cite: | Discovery of Novel Peptidomimetic Boronate ClpP Inhibitors with Noncanonical Enzyme Mechanism as Potent Virulence Blockersin Vitroandin Vivo. J.Med.Chem., 63, 2020
|
|
6A1O
| Crystal structures of disordered Z-type helices | Descriptor: | DNA (5'-D(P*CP*A)-3'), DNA (5'-D(P*CP*AP*CP*A)-3'), DNA (5'-D(P*TP*G)-3'), ... | Authors: | Karthik, S, Mandal, P.K, Thirugnanasambandam, A, Gautham, N. | Deposit date: | 2018-06-07 | Release date: | 2019-01-16 | Last modified: | 2023-11-22 | Method: | X-RAY DIFFRACTION (2.49 Å) | Cite: | Crystal structures of disordered Z-type helices. Nucleosides Nucleotides Nucleic Acids, 38, 2019
|
|
3HRQ
| |
3T1V
| MglA bound to GDP in P2(1) tetrameric arrangement | Descriptor: | GUANOSINE-5'-DIPHOSPHATE, Gliding protein mglA | Authors: | Miertzschke, M, Vetter, I.R, Koerner, C, Wittinghofer, A. | Deposit date: | 2011-07-22 | Release date: | 2011-08-31 | Last modified: | 2011-11-02 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Structural analysis of the Ras-like G protein MglA and its cognate GAP MglB and implications for bacterial polarity. Embo J., 30, 2011
|
|
6JYU
| Crystal structure of Human G6PD Canton | Descriptor: | Glucose-6-phosphate 1-dehydrogenase, NADP NICOTINAMIDE-ADENINE-DINUCLEOTIDE PHOSPHATE | Authors: | Au, S.W.N. | Deposit date: | 2019-04-28 | Release date: | 2020-04-29 | Last modified: | 2024-03-27 | Method: | X-RAY DIFFRACTION (1.89 Å) | Cite: | Crystal structure of Human G6PD Canton To Be Published
|
|
7DFN
| Crystal structure of glycoside hydrolase family 11 beta-xylanase from Streptomyces olivaceoviridis E-86 in complex with alpha-L-arabinofuranosyl xylotetraose | Descriptor: | CHLORIDE ION, Endo-1,4-beta-xylanase, SODIUM ION, ... | Authors: | Fujimoto, Z, Kishine, N, Kaneko, S. | Deposit date: | 2020-11-09 | Release date: | 2020-12-30 | Last modified: | 2023-11-29 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Structure-based substrate specificity analysis of GH11 xylanase from Streptomyces olivaceoviridis E-86. Appl.Microbiol.Biotechnol., 105, 2021
|
|
7MNW
| Crystal Structure of Nup358/RanBP2 Ran-binding domain 1 in complex with Ran-GPPNHP | Descriptor: | E3 SUMO-protein ligase RanBP2, GTP-binding nuclear protein Ran, MAGNESIUM ION, ... | Authors: | Bley, C.J, Nie, S, Mobbs, G.W, Petrovic, S, Gres, A.T, Liu, X, Mukherjee, S, Harvey, S, Huber, F.M, Lin, D.H, Brown, B, Tang, A.W, Rundlet, E.J, Correia, A.R, Chen, S, Regmi, S.G, Stevens, T.A, Jette, C.A, Dasso, M, Patke, A, Palazzo, A.F, Kossiakoff, A.A, Hoelz, A. | Deposit date: | 2021-05-01 | Release date: | 2022-06-15 | Last modified: | 2023-10-18 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Architecture of the cytoplasmic face of the nuclear pore. Science, 376, 2022
|
|
1QWA
| NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12. | Descriptor: | 18S ribosomal RNA, 5'ETS | Authors: | Finger, L.D, Trantirek, L, Johansson, C, Feigon, J. | Deposit date: | 2003-09-01 | Release date: | 2003-11-25 | Last modified: | 2024-05-01 | Method: | SOLUTION NMR | Cite: | Solution Strucutres of Stem-loop RNAs that Bind to the Two N-terminal RNA Binding Domains of Nucleolin Nucleic Acids Res., 31, 2003
|
|
3LJU
| Crystal structure of full length centaurin alpha-1 bound with the head group of PIP3 | Descriptor: | (2R)-3-{[(R)-{[(1S,2S,3R,4S,5S,6S)-2,6-dihydroxy-3,4,5-tris(phosphonooxy)cyclohexyl]oxy}(hydroxy)phosphoryl]oxy}propane -1,2-diyl dioctanoate, Arf-GAP with dual PH domain-containing protein 1, ZINC ION | Authors: | Shen, L, Tong, Y, Tempel, W, MacKenzie, F, Arrowsmith, C.H, Edwards, A.M, Bountra, C, Weigelt, J, Bochkarev, A, Park, H, Structural Genomics Consortium (SGC) | Deposit date: | 2010-01-26 | Release date: | 2010-11-24 | Last modified: | 2023-09-06 | Method: | X-RAY DIFFRACTION (1.702 Å) | Cite: | Phosphorylation-independent dual-site binding of the FHA domain of KIF13 mediates phosphoinositide transport via centaurin alpha1. Proc.Natl.Acad.Sci.USA, 107, 2010
|
|