PDB: 20545 resultsInfo pagesStatus searchChemie searchBIRD

---

6F7N	NMR structure of EphA2-Sam stapled peptides (S13STshort) Descriptor: Ephrin type-A receptor 2 Authors: Mercurio, F.A, Leone, M. Deposit date: 2017-12-11 Release date: 2018-08-01 Last modified: 2023-11-15 Method: SOLUTION NMR Cite: Sam domain-based stapled peptides: Structural analysis and interaction studies with the Sam domains from the EphA2 receptor and the lipid phosphatase Ship2. Bioorg. Chem., 80, 2018
6F7O	NMR structure of an Odin-Sam1 stapled peptide Descriptor: Ankyrin repeat and SAM domain-containing protein 1A Authors: Leone, M, Mercurio, F.A. Deposit date: 2017-12-11 Release date: 2018-08-01 Last modified: 2023-11-15 Method: SOLUTION NMR Cite: Sam domain-based stapled peptides: Structural analysis and interaction studies with the Sam domains from the EphA2 receptor and the lipid phosphatase Ship2. Bioorg. Chem., 80, 2018
1ZV6	NMR structure of the human dematin headpiece S74E mutant Descriptor: EPB49 protein Authors: Jiang, Z.G, McKnight, C.J. Deposit date: 2005-06-01 Release date: 2006-03-21 Last modified: 2024-05-22 Method: SOLUTION NMR Cite: A phosphorylation-induced conformation change in dematin headpiece. Structure, 14, 2006
6FDP	NMR structure of the second TPR domain of the human RPAP3 protein in complex with HSP90 peptide DTSRMEEVD Descriptor: Heat shock protein HSP 90-alpha, RNA polymerase II-associated protein 3 Authors: Quinternet, M, Chagot, M.E, Manival, X. Deposit date: 2017-12-26 Release date: 2018-08-01 Last modified: 2024-06-19 Method: SOLUTION NMR Cite: Deep Structural Analysis of RPAP3 and PIH1D1, Two Components of the HSP90 Co-chaperone R2TP Complex. Structure, 26, 2018
6F27	NMR solution structure of non-bound [des-Arg10]-kallidin (DAKD) Descriptor: DAKD Authors: Richter, C, Jonker, H.R.A, Schwalbe, H, Joedicke, L, Mao, J, Kuenze, G, Reinhart, C, Kalavacherla, T, Meiler, J, Preu, J, Michel, H, Glaubitz, C. Deposit date: 2017-11-23 Release date: 2018-01-10 Last modified: 2024-06-19 Method: SOLUTION NMR Cite: The molecular basis of subtype selectivity of human kinin G-protein-coupled receptors. Nat. Chem. Biol., 14, 2018
6FDT	NMR structure of the second TPR domain of the human RPAP3 protein in complex with HSP70 peptide SGPTIEEVD Descriptor: Heat shock 70 kDa protein 1B, RNA polymerase II-associated protein 3 Authors: Quinternet, M, Chagot, M.E, Manival, X. Deposit date: 2017-12-26 Release date: 2018-08-01 Last modified: 2024-06-19 Method: SOLUTION NMR Cite: Deep Structural Analysis of RPAP3 and PIH1D1, Two Components of the HSP90 Co-chaperone R2TP Complex. Structure, 26, 2018
8CWX	NMR structure of a Stapled Lanthipeptide Natural Product Descriptor: Lanthipeptide Natural Product mSmoAc Authors: Pei, Z, Zhu, L, Nair, S.K. Deposit date: 2022-05-19 Release date: 2022-10-12 Last modified: 2024-07-10 Method: SOLUTION NMR Cite: Class V Lanthipeptide Cyclase Directs the Biosynthesis of a Stapled Peptide Natural Product. J.Am.Chem.Soc., 144, 2022
5XQM	NMR solution structure of SMO1, Sumo homologue in Caenorhabditis elegans Descriptor: Small ubiquitin-related modifier Authors: Gowda, C.M, Surana, P, Das, R. Deposit date: 2017-06-07 Release date: 2017-11-08 Last modified: 2024-05-01 Method: SOLUTION NMR Cite: Structural and functional analysis of SMO-1, the SUMO homolog in Caenorhabditis elegans PLoS ONE, 12, 2017
8DIJ	NMR Structure of Streptococcal Protein GB1 Backbone Modified Variant: beta-ACPC24, beta-3-Lys28, beta-3-Lys31, beta-ACPC35 Descriptor: Immunoglobulin G-binding protein G Authors: Rao, S.R, Reinert, Z.E. Deposit date: 2022-06-29 Release date: 2022-11-23 Last modified: 2023-11-15 Method: SOLUTION NMR Cite: Chemical Shifts of Artificial Monomers Used to Construct Heterogeneous-Backbone Protein Mimetics in Random Coil and Folded States. Pept Sci (Hoboken), 115, 2023
1QFR	NMR SOLUTION STRUCTURE OF PHOSPHOCARRIER PROTEIN HPR FROM ENTEROCOCCUS FAECALIS Descriptor: PHOSPHOCARRIER PROTEIN HPR Authors: Maurer, T, Doeker, R, Goerler, A, Hengstenberg, W, Kalbitzer, H.R. Deposit date: 1999-04-13 Release date: 2001-02-28 Last modified: 2023-12-27 Method: SOLUTION NMR Cite: Three-dimensional structure of the histidine-containing phosphocarrier protein (HPr) from Enterococcus faecalis in solution. Eur.J.Biochem., 268, 2001
6FS5	NMR structure of Casocidin-I antimicrobial peptide in 60% TFE Descriptor: Alpha-S2-casein Authors: Mercurio, F.A, Leone, M. Deposit date: 2018-02-19 Release date: 2018-10-03 Last modified: 2024-06-19 Method: SOLUTION NMR Cite: The antimicrobial peptides casocidins I and II: Solution structural studies in water and different membrane-mimetic environments. Peptides, 114, 2019
1GO0	NMR Structure of Ribosomal Protein L30e from Thermococcus celer Descriptor: 50S RIBOSOMAL PROTEIN L30E Authors: Chan, S.-H, Bycroft, M, Freund, S.M.V, Wong, K.-B. Deposit date: 2001-10-15 Release date: 2003-06-12 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: Solution Structure and Thermal Stability of Ribosomal Protein L30E from Hyperthermophilic Archaeon Thermococcus Celer Protein Sci., 12, 2003
5T17	NMR structure of the E. coli protein NPr, residues 1-85 Descriptor: Phosphocarrier protein NPr Authors: Wang, G, Li, X, Peterkofsky, A. Deposit date: 2016-08-18 Release date: 2016-09-28 Last modified: 2024-05-01 Method: SOLUTION NMR Cite: Solution structure of NPr, a bacterial signal-transducing protein that controls the phosphorylation state of the potassium transporter-regulating protein IIA Ntr. Amino Acids, 35, 2008
2A2Y	NMR Structue of Sso10b2 from Sulfolobus solfataricus Descriptor: DNA/RNA-binding protein Alba 2 Authors: Biyani, K, Kahsai, M.A, Clark, A.T, Armstrong, T.L, Edmondson, S.P, Shriver, J.W. Deposit date: 2005-06-23 Release date: 2005-11-08 Last modified: 2024-05-22 Method: SOLUTION NMR Cite: Solution structure, stability, and nucleic Acid binding of the hyperthermophile protein sso10b2. Biochemistry, 44, 2005
1QM9	NMR, REPRESENTATIVE STRUCTURE Descriptor: POLYPYRIMIDINE TRACT-BINDING PROTEIN Authors: Conte, M.R, Grune, T, Curry, S, Matthews, S. Deposit date: 1999-09-22 Release date: 2000-07-03 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: Structure of Tandem RNA Recognition Motifs from Polypyrimidine Tract Binding Protein Reveals Novel Features of the Rrm Fold Embo J., 19, 2000
8FLP	NMR Solution Structure of LvIC analogue Descriptor: Alpha-conotoxin LvIC analogue Authors: Harvey, P.J, Craik, D.J. Deposit date: 2022-12-22 Release date: 2023-02-08 Last modified: 2023-02-22 Method: SOLUTION NMR Cite: Discovery, Characterization, and Engineering of LvIC, an alpha 4/4-Conotoxin That Selectively Blocks Rat alpha 6/ alpha 3 beta 4 Nicotinic Acetylcholine Receptors. J.Med.Chem., 66, 2023
5A4G	NMR structure of a 180 residue construct encompassing the N-terminal metal-binding site and the membrane proximal domain of SilB from Cupriavidus metallidurans CH34 Descriptor: SILB, SILVER EFFLUX PROTEIN, MFP COMPONENT OF THE THREE COMPONENTS PROTON ANTIPORTER METAL EFFLUX SYSTEM, ... Authors: Bersch, B, Urbina Fernandez, P, Vandenbussche, G. Deposit date: 2015-06-09 Release date: 2016-05-18 Last modified: 2024-06-19 Method: SOLUTION NMR Cite: Structural and Functional Investigation of the Ag+/Cu+-Binding Domains of the Periplasmic Adaptor Protein Silb from Cupriavidus Metallidurans Ch34. Biochemistry, 55, 2016
6WPO	NMR Structure of HSP-4 antimicrobial peptide in presence of DPC-d38 micelles Descriptor: Hylaseptin-4 Authors: Verly, R.M, Nunes, L.O. Deposit date: 2020-04-27 Release date: 2021-03-17 Method: SOLUTION NMR Cite: High-resolution structural profile of hylaseptin-4: Aggregation, membrane topology and pH dependence of overall membrane binding process. Biochim Biophys Acta Biomembr, 1863, 2021
7JGI	NMR structure of the cNTnC-cTnI chimera bound to A7 Descriptor: 7-{[(5-chloronaphthalen-1-yl)sulfonyl]amino}heptanoic acid, CALCIUM ION, Troponin C, ... Authors: Cai, F, Robertson, I.M, Kampourakis, T, Klein, B.A, Sykes, B.D. Deposit date: 2020-07-19 Release date: 2020-09-02 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: The Role of Electrostatics in the Mechanism of Cardiac Thin Filament Based Sensitizers. Acs Chem.Biol., 15, 2020
6W4E	NMR-driven structure of KRAS4B-GTP homodimer on a lipid bilayer nanodisc Descriptor: 1,2-DIOLEOYL-SN-GLYCERO-3-PHOSPHOCHOLINE, 5'-GUANOSINE-DIPHOSPHATE-MONOTHIOPHOSPHATE, Apolipoprotein A-I, ... Authors: Lee, K, Fang, Z, Enomoto, M, Gasmi-Seabrook, G.M, Zheng, L, Marshall, C.B, Ikura, M. Deposit date: 2020-03-10 Release date: 2020-04-15 Last modified: 2024-05-01 Method: SOLUTION NMR Cite: Two Distinct Structures of Membrane-Associated Homodimers of GTP- and GDP-Bound KRAS4B Revealed by Paramagnetic Relaxation Enhancement. Angew.Chem.Int.Ed.Engl., 59, 2020
8I26	NMR structure of Toxoplasma gondii PDCD5 (cis form) Descriptor: Programmed cell death 5 protein Authors: Lin, M.H, Hsu, C.H. Deposit date: 2023-01-14 Release date: 2024-01-17 Last modified: 2024-06-12 Method: SOLUTION NMR Cite: Proline Isomerization and Molten Globular Property of TgPDCD5 Secreted from Toxoplasma gondii Confers Its Regulation of Heparin Sulfate Binding. Jacs Au, 4, 2024
8I25	NMR structure of Toxoplasma gondii PDCD5 (trans form) Descriptor: Programmed cell death 5 protein Authors: Lin, M.H, Hsu, C.H. Deposit date: 2023-01-14 Release date: 2024-01-17 Last modified: 2024-06-12 Method: SOLUTION NMR Cite: Proline Isomerization and Molten Globular Property of TgPDCD5 Secreted from Toxoplasma gondii Confers Its Regulation of Heparin Sulfate Binding. Jacs Au, 4, 2024
1QWB	NMR structure of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12 Descriptor: sNRE26 Authors: Finger, L.D, Trantirek, L, Johansson, C, Feigon, J. Deposit date: 2003-09-01 Release date: 2003-11-25 Last modified: 2024-05-01 Method: SOLUTION NMR Cite: Solution Structures of Stem-loop RNAs that Bind the Two N-terminal RNA-binding Domains of Nucleolin Nucleic Acids Res., 31, 2003
7KAA	NMR solution structures of tirasemtiv drug bound to a fast skeletal troponin C-troponin I complex Descriptor: 6-ethynyl-1-(pentan-3-yl)-1H-imidazo[4,5-b]pyrazin-2-ol, CALCIUM ION, Troponin C, ... Authors: Mercier, P, Li, M.X, Hartman, J.J, Sykes, B.D. Deposit date: 2020-09-30 Release date: 2021-03-24 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: Structural Basis of Tirasemtiv Activation of Fast Skeletal Muscle. J.Med.Chem., 64, 2021
5AIW	NMR solution structure of the putative transfer protein TraH from Gram-positive conjugative plasmid pIP501 Descriptor: TRAH Authors: Meyer, N.H, Fercher, C, Zangger, K, Keller, W. Deposit date: 2015-02-18 Release date: 2016-03-09 Last modified: 2024-06-19 Method: SOLUTION NMR Cite: Virb8-Like Protein Trah is Crucial for DNA Transfer in Enterococcus Faecalis. Sci.Rep., 6, 2016

<107108109110111112113114115116117118119120121122>