PDB: 20505 resultsInfo pagesStatus searchChemie searchBIRD

---

5J18	Solution structure of Ras Binding Domain (RBD) of B-Raf complexed with Rigosertib (Complex I) Descriptor: N-[2-methoxy-5-({[(E)-2-(2,4,6-trimethoxyphenyl)ethenyl]sulfonyl}methyl)phenyl]glycine, Serine/threonine-protein kinase B-raf Authors: Dutta, K, Vasquez-Del Carpio, R, Aggarwal, A.K, Reddy, E.P. Deposit date: 2016-03-29 Release date: 2016-05-04 Last modified: 2024-05-01 Method: SOLUTION NMR Cite: A Small Molecule RAS-Mimetic Disrupts RAS Association with Effector Proteins to Block Signaling. Cell, 165, 2016
2RSO	Solution structure of the chromodomain of Swi6 Descriptor: Chromatin-associated protein swi6 Authors: Shimojo, H, Nishimura, Y. Deposit date: 2012-04-18 Release date: 2012-08-29 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: Intrinsic nucleic Acid-binding activity of chp1 chromodomain is required for heterochromatic gene silencing Mol.Cell, 47, 2012
2RTY	Solution structure of navitoxin Descriptor: navitoxin Authors: Umetsu, Y, Ohki, S. Deposit date: 2013-10-16 Release date: 2014-04-23 Last modified: 2023-06-14 Method: SOLUTION NMR Cite: Experimental conversion of a defensin into a neurotoxin: implications for origin of toxic function MOL.BIOL.EVOL., 31, 2014
2ROL	Structural Basis of PxxDY motif recognition in SH3 binding Descriptor: 12-meric peptide from T-cell surface glycoprotein CD3 epsilon chain, Epidermal growth factor receptor kinase substrate 8-like protein 1 Authors: Aitio, O, Hellman, M, Kesti, T, Kleino, I, Samuilova, O, Tossavainen, H, Paakkonen, K, Saksela, K, Permi, P. Deposit date: 2008-04-02 Release date: 2009-03-03 Last modified: 2024-05-01 Method: SOLUTION NMR Cite: Structural basis of PxxDY motif recognition in SH3 binding J.Mol.Biol., 382, 2008
2RTT	Solution structure of the chitin-binding domain of Chi18aC from Streptomyces coelicolor Descriptor: ChiC Authors: Okumura, A, Uemura, M, Yamada, N, Chikaishi, E, Takai, T, Yoshio, S, Akagi, K, Morita, J, Lee, Y, Yokogawa, D, Suzuki, K, Watanabe, T, Ikegami, T. Deposit date: 2013-08-26 Release date: 2014-08-27 Last modified: 2024-05-01 Method: SOLUTION NMR Cite: Solution structure of the Chitin-binding domain of chitinase Chi18aC from Streptomyces coelicolor To be Published
2RU0	Solution structure of actinomycesin Descriptor: Arthropod defensin Authors: Umetsu, Y, Gao, B, Zhu, S, Ohki, S. Deposit date: 2013-10-17 Release date: 2014-10-22 Last modified: 2023-06-14 Method: SOLUTION NMR Cite: Solution structure of actinomycesin To be Published
2RON	The external thioesterase of the Surfactin-Synthetase Descriptor: Surfactin synthetase thioesterase subunit Authors: Koglin, A, Lohr, F, Bernhard, F, Rogov, V.V, Frueh, D.P, Strieter, E.R, Mofid, M.R, Guentert, P, Wagner, G, Walsh, C.T, Marahiel, M.A, Doetsch, V. Deposit date: 2008-04-04 Release date: 2008-08-12 Last modified: 2024-05-01 Method: SOLUTION NMR Cite: Structural basis for the selectivity of the external thioesterase of the surfactin synthetase Nature, 454, 2008
2RMN	The solution structure of the p63 DNA-binding domain Descriptor: Tumor protein 63, ZINC ION Authors: Enthart, A, Kessler, H. Deposit date: 2007-11-01 Release date: 2008-11-11 Last modified: 2024-05-01 Method: SOLUTION NMR Cite: Solution structure and binding specificity of the p63 DNA binding domain Sci Rep, 6, 2016
2RMS	Solution structure of the mSin3A PAH1-SAP25 SID complex Descriptor: MSin3A-binding protein, Paired amphipathic helix protein Sin3a Authors: Sahu, S.C, Swanson, K.A, Kang, R.S, Huang, K, Brubaker, K, Ratcliff, K, Radhakrishnan, I. Deposit date: 2007-11-14 Release date: 2008-01-22 Last modified: 2024-05-29 Method: SOLUTION NMR Cite: Conserved Themes in Target Recognition by the PAH1 and PAH2 Domains of the Sin3 Transcriptional Corepressor J.Mol.Biol., 375, 2007
5TP6	Solution structure of the CaM34 with the iNOS CaM binding domain peptide Descriptor: Calmodulin, Nitric oxide synthase, inducible Authors: Piazza, M, Dieckmann, T, Guillemette, J.G. Deposit date: 2016-10-19 Release date: 2017-09-27 Last modified: 2024-05-01 Method: SOLUTION NMR Cite: Structural Consequences of Calmodulin EF Hand Mutations. Biochemistry, 56, 2017
5J2R	Solution structure of Ras Binding Domain (RBD) of B-Raf Descriptor: N-[2-methoxy-5-({[(E)-2-(2,4,6-trimethoxyphenyl)ethenyl]sulfonyl}methyl)phenyl]glycine, Serine/threonine-protein kinase B-raf Authors: Dutta, K, Vasquez-Del Carpio, R, Aggarwal, A.K, Reddy, E.P. Deposit date: 2016-03-29 Release date: 2016-05-04 Last modified: 2024-05-01 Method: SOLUTION NMR Cite: A Small Molecule RAS-Mimetic Disrupts RAS Association with Effector Proteins to Block Signaling. Cell, 165, 2016
5J6U	DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium Descriptor: DNA (25-MER) Authors: Dvorkin, S.A, Karsisiotis, A.I, Webba da Silva, M. Deposit date: 2016-04-05 Release date: 2017-05-10 Last modified: 2024-06-19 Method: SOLUTION NMR Cite: Encoding canonical DNA quadruplex structure. Sci Adv, 4, 2018
5JPL	LP2006, a handcuff-topology lasso peptide antibiotic Descriptor: Uncharacterized protein Authors: Tietz, J.I, Schwalen, C.J, Blair, P.M, Zakai, U.I, Mitchell, D.A. Deposit date: 2016-05-03 Release date: 2017-03-01 Last modified: 2023-06-14 Method: SOLUTION NMR Cite: A new genome-mining tool redefines the lasso peptide biosynthetic landscape. Nat. Chem. Biol., 13, 2017
6PQ2	Structural Basis for Client Recognition and Activity of Hsp40 Chaperones Descriptor: Alkaline phosphatase,Chaperone DnaJ domain-containing protein fusion Authors: Jiang, Y, Rossi, P, Kalodimos, C.G. Deposit date: 2019-07-08 Release date: 2019-09-18 Last modified: 2024-05-01 Method: SOLUTION NMR Cite: Structural basis for client recognition and activity of Hsp40 chaperones. Science, 365, 2019
5TTB	Solution structure of apo ArCP from yersiniabactin synthetase Descriptor: Siderophore yersiniabactin Authors: Frueh, D.P, Goodrich, A.C. Deposit date: 2016-11-02 Release date: 2017-05-10 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: Molecular impact of covalent modifications on nonribosomal peptide synthetase carrier protein communication. J. Biol. Chem., 292, 2017
5TP5	Solution structure of the calcium deficient mutant calmodulin CaM1234 Descriptor: Calmodulin Authors: Piazza, M, Dieckmann, T, Guillemette, J.G. Deposit date: 2016-10-19 Release date: 2017-09-27 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: Structural Consequences of Calmodulin EF Hand Mutations. Biochemistry, 56, 2017
6PMG	Solution structure of the C-terminal zinc finger of the C. elegans protein MEX-5 Descriptor: ZINC ION, Zinc finger protein mex-5 Authors: Massi, F, Tavella, D. Deposit date: 2019-07-01 Release date: 2020-04-29 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: A Disorder-to-Order Transition Mediates RNA Binding of the Caenorhabditis elegans Protein MEX-5. Biophys.J., 118, 2020
6PQE	Structural Basis for Client Recognition and Activity of Hsp40 Chaperones Descriptor: Alkaline phosphatase,Chaperone protein DnaJ 2 fusion Authors: Jiang, Y, Rossi, P, Kalodimos, C.G. Deposit date: 2019-07-09 Release date: 2019-09-18 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: Structural basis for client recognition and activity of Hsp40 chaperones. Science, 365, 2019
6PRI	Structural Basis for Client Recognition and Activity of Hsp40 Chaperones Descriptor: Alkaline phosphatase,Chaperone protein DnaJ 2 Authors: Jiang, Y, Rossi, P, Kalodimos, C.G. Deposit date: 2019-07-10 Release date: 2019-09-18 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: Structural basis for client recognition and activity of Hsp40 chaperones. Science, 365, 2019
6PSI	Structural Basis for Client Recognition and Activity of Hsp40 Chaperones Descriptor: Alkaline phosphatase, Chaperone protein DnaJ 2 Authors: Jiang, Y, Rossi, P, Kalodimos, C.G. Deposit date: 2019-07-12 Release date: 2019-09-18 Last modified: 2024-05-01 Method: SOLUTION NMR Cite: Structural basis for client recognition and activity of Hsp40 chaperones. Science, 365, 2019
5T56	[3]catenane from MccJ25 G12R/I13C/G21C lasso peptide Descriptor: Microcin J25 Authors: Link, A.J, Allen, C.D. Deposit date: 2016-08-30 Release date: 2017-07-12 Last modified: 2023-06-14 Method: SOLUTION NMR Cite: Self-Assembly of Catenanes from Lasso Peptides. J. Am. Chem. Soc., 138, 2016
5V4U	Solution structure of VKK38 bound to plasminogen kringle 2 Descriptor: M protein Authors: Yuan, Y, Castellino, F. Deposit date: 2017-03-10 Release date: 2017-07-26 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: Conformationally organized lysine isosteres in Streptococcus pyogenes M protein mediate direct high-affinity binding to human plasminogen. J. Biol. Chem., 292, 2017
6QK5	Solution Structure of the Zn-loaded form of a Metallothionein from Helix Pomatia Descriptor: Cadmium-metallothionein, ZINC ION Authors: Zerbe, O, Jurt, S, Beil, A. Deposit date: 2019-01-28 Release date: 2019-12-18 Last modified: 2024-06-19 Method: SOLUTION NMR Cite: The Solution Structure and Dynamics of Cd-Metallothionein fromHelix pomatiaReveal Optimization for Binding Cd over Zn. Biochemistry, 58, 2019
2RSI	Solution structures of the DNA-binding domains of immune-related zinc-finger protein ZFAT Descriptor: ZINC ION, Zinc finger protein ZFAT Authors: Tochio, N, Umehara, T, Kigawa, T, Yokoyama, S. Deposit date: 2012-03-07 Release date: 2013-03-13 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: Solution structures of the DNA-binding domains of immune-related zinc-finger protein ZFAT To be Published
2RUG	Refined solution structure of the first RNA recognition motif domain in CPEB3 Descriptor: Cytoplasmic polyadenylation element-binding protein 3 Authors: Tsuda, K, Kuwasako, K, Nagata, T, Takahashi, M, Kigawa, T, Kobayashi, N, Guntert, P, Shirouzu, M, Yokoyama, S, Muto, Y, RIKEN Structural Genomics/Proteomics Initiative (RSGI) Deposit date: 2014-04-15 Release date: 2014-09-17 Last modified: 2024-05-15 Method: SOLUTION NMR Cite: Novel RNA recognition motif domain in the cytoplasmic polyadenylation element binding protein 3. Proteins, 82, 2014

<402403404405406407408409410411412413414415416417>