5J6U

DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium

Summary for 5J6U

Entry DOI	10.2210/pdb5j6u/pdb
NMR Information	BMRB: 30058
Descriptor	DNA (25-MER) (1 entity in total)
Functional Keywords	programmed design of g-quadruplex folding topology, structure from molmol, dna
Biological source	synthetic construct
Total number of polymer chains	1
Total formula weight	7978.10
Authors	Dvorkin, S.A.,Karsisiotis, A.I.,Webba da Silva, M. (deposition date: 2016-04-05, release date: 2017-05-10, Last modification date: 2024-06-19)
Primary citation	Dvorkin, S.A.,Karsisiotis, A.I.,Webba da Silva, M. Encoding canonical DNA quadruplex structure. Sci Adv, 4:eaat3007-eaat3007, 2018 Cited by PubMed Abstract: The main challenge in DNA quadruplex design is to encode a three-dimensional structure into the primary sequence, despite its multiple, repetitive guanine segments. We identify and detail structural elements describing all 14 feasible canonical quadruplex scaffolds and demonstrate their use in control of design. This work outlines a new roadmap for implementation of targeted design of quadruplexes for material, biotechnological, and therapeutic applications. PubMed: 30182059 DOI: 10.1126/sciadv.aat3007 PDB entries with the same primary citation
Experimental method	SOLUTION NMR

Structure validation