5J6U
DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium
Entity
Entity ID | Chain ID | Description | Type | Chain length | Formula weight | Number of molecules | DB Name (Accession) | Biological source | Descriptive keywords |
1 | A | DNA (25-MER) | polymer | 25 | 7978.1 | 1 | synthetic construct |
Sequence viewer
Contents of the asymmetric unit
Polymers | Number of chains | 1 |
Total formula weight | 7978.1 | |
All* | Total formula weight | 7978.1 |