1GMI
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1gmi by Molmil](/molmil-images/mine/1gmi) | Structure of the c2 domain from novel protein kinase C epsilon | Descriptor: | MAGNESIUM ION, PROTEIN KINASE C, EPSILON TYPE | Authors: | Ochoa, W.F, Garcia-Garcia, J, Fita, I, Corbalan-Garcia, S, Verdaguer, N, Gomez-Fernandez, J.C. | Deposit date: | 2001-09-14 | Release date: | 2001-10-25 | Last modified: | 2024-05-08 | Method: | X-RAY DIFFRACTION (1.7 Å) | Cite: | Structure of the C2 Domain from Novel Protein Kinase Cepsilon. A Membrane Binding Model for Ca(2+ )-Independent C2 Domains J.Mol.Biol., 311, 2001
|
|
4AYQ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4ayq by Molmil](/molmil-images/mine/4ayq) | Structure of The GH47 processing alpha-1,2-mannosidase from Caulobacter strain K31 in complex with mannoimidazole | Descriptor: | (5R,6R,7S,8R)-5-(HYDROXYMETHYL)-5,6,7,8-TETRAHYDROIMIDAZO[1,2-A]PYRIDINE-6,7,8-TRIOL, CALCIUM ION, DI(HYDROXYETHYL)ETHER, ... | Authors: | Thompson, A.J, Dabin, J, Iglesias-Fernandez, J, Iglesias-Fernandez, A, Dinev, Z, Williams, S.J, Siriwardena, A, Moreland, C, Hu, T.C, Smith, D.K, Gilbert, H.J, Rovira, C, Davies, G.J. | Deposit date: | 2012-06-21 | Release date: | 2013-01-30 | Last modified: | 2024-05-01 | Method: | X-RAY DIFFRACTION (1.1 Å) | Cite: | The Reaction Coordinate of a Bacterial Gh47 Alpha-Mannosidase: A Combined Quantum Mechanical and Structural Approach. Angew.Chem.Int.Ed.Engl., 51, 2012
|
|
4D4B
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4d4b by Molmil](/molmil-images/mine/4d4b) | The catalytic domain, BcGH76, of Bacillus circulans Aman6 in complex with MSMSMe | Descriptor: | 1,2-ETHANEDIOL, ALPHA-1,6-MANNANASE, alpha-D-mannopyranose-(1-6)-methyl 1,6-dithio-alpha-D-mannopyranoside | Authors: | Thompson, A.J, Speciale, G, Iglesias-Fernandez, J, Hakki, Z, Belz, T, Cartmell, A, Spears, R.J, Stepper, J, Gilbert, H.J, Rovira, C, Williams, S.J, Davies, G.J. | Deposit date: | 2014-10-27 | Release date: | 2015-03-25 | Last modified: | 2024-05-01 | Method: | X-RAY DIFFRACTION (1.3 Å) | Cite: | Evidence for a Boat Conformation at the Transition State of Gh76 Alpha-1,6-Mannanases- Key Enzymes in Bacterial and Fungal Mannoprotein Metabolism Angew.Chem.Int.Ed.Engl., 54, 2015
|
|
4D0T
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4d0t by Molmil](/molmil-images/mine/4d0t) | GalNAc-T2 crystal soaked with UDP-GalNAc, EA2 peptide and manganese | Descriptor: | 1,2-ETHANEDIOL, 2-acetamido-2-deoxy-beta-D-galactopyranose, MANGANESE (II) ION, ... | Authors: | Lira-Navarrete, E, Iglesias-Fernandez, J, Zandberg, W.F, Companon, I, Kong, Y, Corzana, F, Pinto, B.M, Clausen, H, Peregrina, J.M, Vocadlo, D, Rovira, C, Hurtado-Guerrero, R. | Deposit date: | 2014-04-30 | Release date: | 2014-05-28 | Last modified: | 2023-12-20 | Method: | X-RAY DIFFRACTION (2.45 Å) | Cite: | Substrate-Guided Front-Face Reaction Revealed by Combined Structural Snapshots and Metadynamics for the Polypeptide N-Acetylgalactosaminyltransferase 2. Angew.Chem.Int.Ed.Engl., 53, 2014
|
|
4D4C
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4d4c by Molmil](/molmil-images/mine/4d4c) | The catalytic domain, BcGH76, of Bacillus circulans Aman6 in complex with 1,6-ManDMJ | Descriptor: | 1,2-ETHANEDIOL, 1-DEOXYMANNOJIRIMYCIN, ALPHA-1,6-MANNANASE, ... | Authors: | Thompson, A.J, Speciale, G, Iglesias-Fernandez, J, Hakki, Z, Belz, T, Cartmell, A, Spears, R.J, Stepper, J, Gilbert, H.J, Rovira, C, Williams, S.J, Davies, G.J. | Deposit date: | 2014-10-27 | Release date: | 2015-03-25 | Last modified: | 2024-05-01 | Method: | X-RAY DIFFRACTION (1.3 Å) | Cite: | Evidence for a Boat Conformation at the Transition State of Gh76 Alpha-1,6-Mannanases- Key Enzymes in Bacterial and Fungal Mannoprotein Metabolism Angew.Chem.Int.Ed.Engl., 54, 2015
|
|
4D0Z
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4d0z by Molmil](/molmil-images/mine/4d0z) | GalNAc-T2 crystal soaked with UDP-5SGalNAc, mEA2 and manganese (Higher resolution dataset) | Descriptor: | (2R,3R,4R,5R,6R)-3-(acetylamino)-4,5-dihydroxy-6-(hydroxymethyl)tetrahydro-2H-thiopyran-2-yl [(2R,3S,4R,5R)-5-(2,4-dioxo-3,4-dihydropyrimidin-1(2H)-yl)-3,4-dihydroxytetrahydrofuran-2-yl]methyl dihydrogen diphosphate, 1,2-ETHANEDIOL, 2-acetamido-2-deoxy-5-thio-alpha-D-galactopyranose, ... | Authors: | Lira-Navarrete, E, Iglesias-Fernandez, J, Zandberg, W.F, Companon, I, Kong, Y, Corzana, F, Pinto, B.M, Clausen, H, Peregrina, J.M, Vocadlo, D, Rovira, C, Hurtado-Guerrero, R. | Deposit date: | 2014-04-30 | Release date: | 2014-05-28 | Last modified: | 2023-12-20 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | Substrate-Guided Front-Face Reaction Revealed by Combined Structural Snapshots and Metadynamics for the Polypeptide N- Acetylgalactosaminyltransferase 2. Angew.Chem.Int.Ed.Engl., 53, 2014
|
|
4D4D
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4d4d by Molmil](/molmil-images/mine/4d4d) | The catalytic domain, BcGH76, of Bacillus circulans Aman6 in complex with 1,6-ManIFG | Descriptor: | 1,2-ETHANEDIOL, 5-HYDROXYMETHYL-3,4-DIHYDROXYPIPERIDINE, ALPHA-1,6-MANNANASE, ... | Authors: | Thompson, A.J, Speciale, G, Iglesias-Fernandez, J, Hakki, Z, Belz, T, Cartmell, A, Spears, R.J, Stepper, J, Gilbert, H.J, Rovira, C, Williams, S.J, Davies, G.J. | Deposit date: | 2014-10-27 | Release date: | 2015-03-25 | Last modified: | 2024-05-01 | Method: | X-RAY DIFFRACTION (1.4 Å) | Cite: | Evidence for a Boat Conformation at the Transition State of Gh76 Alpha-1,6-Mannanases- Key Enzymes in Bacterial and Fungal Mannoprotein Metabolism Angew.Chem.Int.Ed.Engl., 54, 2015
|
|
4D11
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4d11 by Molmil](/molmil-images/mine/4d11) | GalNAc-T2 crystal soaked with UDP-5SGalNAc, mEA2 peptide and manganese (Lower resolution dataset) | Descriptor: | 2-acetamido-2-deoxy-5-thio-alpha-D-galactopyranose, MANGANESE (II) ION, PEPTIDE, ... | Authors: | Lira-Navarrete, E, Iglesias-Fernandez, J, Zandberg, W.F, Companon, I, Kong, Y, Corzana, F, Pinto, B.M, Clausen, H, Peregrina, J.M, Vocadlo, D, Rovira, C, Hurtado-Guerrero, R. | Deposit date: | 2014-05-01 | Release date: | 2014-05-28 | Last modified: | 2023-12-20 | Method: | X-RAY DIFFRACTION (2.85 Å) | Cite: | Substrate-Guided Front-Face Reaction Revealed by Combined Structural Snapshots and Metadynamics for the Polypeptide N- Acetylgalactosaminyltransferase 2. Angew.Chem.Int.Ed.Engl., 53, 2014
|
|
4BMV
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4bmv by Molmil](/molmil-images/mine/4bmv) | Short-chain dehydrogenase from Sphingobium yanoikuyae in complex with NADPH | Descriptor: | NADP NICOTINAMIDE-ADENINE-DINUCLEOTIDE PHOSPHATE, SHORT-CHAIN DEHYDROGENASE | Authors: | Man, H, Kedziora, K, Lavandera-Garcia, I, Gotor-Fernandez, V, Grogan, G. | Deposit date: | 2013-05-10 | Release date: | 2014-03-19 | Last modified: | 2023-12-20 | Method: | X-RAY DIFFRACTION (2.5 Å) | Cite: | Structures of Alcohol Dehydrogenases from Ralstonia and Sphingobium Spp. Reveal the Molecular Basis for Their Recognition of 'Bulky-Bulky' Ketones Top.Catal., 57, 2014
|
|
1K9V
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1k9v by Molmil](/molmil-images/mine/1k9v) | Structural evidence for ammonia tunelling across the (beta-alpha)8-barrel of the imidazole glycerol phosphate synthase bienzyme complex | Descriptor: | ACETIC ACID, Amidotransferase hisH | Authors: | Douangamath, A, Walker, M, Beismann-Driemeyer, S, Vega-Fernandez, M.C, Sterner, R, Wilmanns, M. | Deposit date: | 2001-10-31 | Release date: | 2002-02-20 | Last modified: | 2024-04-03 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Structural evidence for ammonia tunneling across the (beta alpha)(8) barrel of the imidazole glycerol phosphate synthase bienzyme complex. Structure, 10, 2002
|
|
4D4A
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4d4a by Molmil](/molmil-images/mine/4d4a) | Structure of the catalytic domain (BcGH76) of the Bacillus circulans GH76 alpha mannanase, Aman6. | Descriptor: | 1,2-ETHANEDIOL, ALPHA-1,6-MANNANASE | Authors: | Thompson, A.J, Speciale, G, Iglesias-Fernandez, J, Hakki, Z, Belz, T, Cartmell, A, Spears, R.J, Stepper, J, Gilbert, H.J, Rovira, C, Williams, S.J, Davies, G.J. | Deposit date: | 2014-10-27 | Release date: | 2015-03-25 | Last modified: | 2023-12-20 | Method: | X-RAY DIFFRACTION (1.4 Å) | Cite: | Evidence for a Boat Conformation at the Transition State of Gh76 Alpha-1,6-Mannanases- Key Enzymes in Bacterial and Fungal Mannoprotein Metabolism Angew.Chem.Int.Ed.Engl., 54, 2015
|
|
1J7X
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1j7x by Molmil](/molmil-images/mine/1j7x) | |
1MN7
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1mn7 by Molmil](/molmil-images/mine/1mn7) | NDP kinase mutant (H122G;N119S;F64W) in complex with aBAZTTP | Descriptor: | 3'-AZIDO-3'-DEOXY-THYMIDINE-5'-ALPHA BORANO TRIPHOSPHATE, MAGNESIUM ION, NDP kinase | Authors: | gallois-montbrun, s, schneider, b, chen, y, giacomoni-fernandes, v, mulard, l, morera, s, janin, j, deville-bonne, d, veron, m. | Deposit date: | 2002-09-05 | Release date: | 2002-10-02 | Last modified: | 2024-05-29 | Method: | X-RAY DIFFRACTION (2.15 Å) | Cite: | Improving nucleoside diphosphate kinase for antiviral nucleotide analogs activation J.BIOL.CHEM., 277, 2002
|
|
1S1O
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1s1o by Molmil](/molmil-images/mine/1s1o) | |
1SAX
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1sax by Molmil](/molmil-images/mine/1sax) | Three-dimensional structure of s.aureus methicillin-resistance regulating transcriptional repressor meci in complex with 25-bp ds-DNA | Descriptor: | 5'-d(CAAAATTACAACTGTAATATCGGAG)-3', 5'-d(GCTCCGATATTACAGTTGTAATTTT)-3', Methicillin resistance regulatory protein mecI, ... | Authors: | Garcia-Castellanos, R, Mallorqui-Fernandez, G, Marrero, A, Potempa, J, Coll, M, Gomis-Ruth, F.X. | Deposit date: | 2004-02-09 | Release date: | 2004-04-27 | Last modified: | 2023-08-23 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | On the transcriptional regulation of methicillin resistance: MecI repressor in complex with its operator J.Biol.Chem., 279, 2004
|
|
1UNO
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1uno by Molmil](/molmil-images/mine/1uno) | Crystal structure of a d,l-alternating peptide | Descriptor: | H-(L-TYR-D-TYR)4-LYS-OH | Authors: | Alexopoulos, E, Kuesel, A, Uson, I, Diederichsen, U, Sheldrick, G.M. | Deposit date: | 2003-09-11 | Release date: | 2004-09-24 | Last modified: | 2019-07-24 | Method: | X-RAY DIFFRACTION (1.4 Å) | Cite: | Solution and Structure of an Alternating D,L-Peptide Acta Crystallogr.,Sect.D, 60, 2004
|
|
3DNJ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3dnj by Molmil](/molmil-images/mine/3dnj) | The structure of the Caulobacter crescentus ClpS protease adaptor protein in complex with a N-end rule peptide | Descriptor: | ATP-dependent Clp protease adapter protein clpS, MAGNESIUM ION, synthetic N-end rule peptide | Authors: | Wang, K, Roman-Hernandez, G, Grant, R.A, Sauer, R.T, Baker, T.A. | Deposit date: | 2008-07-02 | Release date: | 2008-11-18 | Last modified: | 2024-04-03 | Method: | X-RAY DIFFRACTION (1.15 Å) | Cite: | The molecular basis of N-end rule recognition. Mol.Cell, 32, 2008
|
|
7V93
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7v93 by Molmil](/molmil-images/mine/7v93) | Cryo-EM structure of the Cas12c2-sgRNA binary complex | Descriptor: | cas12c2, sgRNA | Authors: | Kurihara, N, Hirano, H, Tomita, A, Kobayashi, K, Kusakizako, T, Nishizawa, T, Yamashita, K, Nishimasu, H, Nureki, O. | Deposit date: | 2021-08-24 | Release date: | 2022-04-13 | Last modified: | 2024-06-12 | Method: | ELECTRON MICROSCOPY (3 Å) | Cite: | Structure of the type V-C CRISPR-Cas effector enzyme. Mol.Cell, 82, 2022
|
|
1YRG
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1yrg by Molmil](/molmil-images/mine/1yrg) | THE CRYSTAL STRUCTURE OF RNA1P: A NEW FOLD FOR A GTPASE-ACTIVATING PROTEIN | Descriptor: | GTPASE-ACTIVATING PROTEIN RNA1_SCHPO | Authors: | Hillig, R.C, Renault, L, Vetter, I.R, Drell, T, Wittinghofer, A, Becker, J. | Deposit date: | 1999-03-29 | Release date: | 2000-03-29 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (2.66 Å) | Cite: | The crystal structure of rna1p: a new fold for a GTPase-activating protein. Mol.Cell, 3, 1999
|
|
4WC4
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4wc4 by Molmil](/molmil-images/mine/4wc4) | tRNA-processing enzyme complex 2 | Descriptor: | ADENOSINE-5'-TRIPHOSPHATE, Poly A polymerase, RNA (74-MER) | Authors: | Yamashita, S, Tomita, K. | Deposit date: | 2014-09-04 | Release date: | 2015-04-15 | Last modified: | 2024-03-20 | Method: | X-RAY DIFFRACTION (3.501 Å) | Cite: | Measurement of Acceptor-T Psi C Helix Length of tRNA for Terminal A76-Addition by A-Adding Enzyme. Structure, 23, 2015
|
|
9EOW
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 9eow by Molmil](/molmil-images/mine/9eow) | |
5KL1
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5kl1 by Molmil](/molmil-images/mine/5kl1) | Crystal structure of the Pumilio-Nos-hunchback RNA complex | Descriptor: | Maternal protein pumilio, Protein nanos, RNA (5'-R(*AP*AP*AP*UP*UP*GP*UP*AP*CP*AP*UP*A)-3'), ... | Authors: | Qiu, C, Hall, T.M.T. | Deposit date: | 2016-06-23 | Release date: | 2016-08-17 | Last modified: | 2023-09-27 | Method: | X-RAY DIFFRACTION (3.701 Å) | Cite: | Drosophila Nanos acts as a molecular clamp that modulates the RNA-binding and repression activities of Pumilio. Elife, 5, 2016
|
|
2XZL
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2xzl by Molmil](/molmil-images/mine/2xzl) | Upf1-RNA complex | Descriptor: | 5- R(*UP*UP*UP*UP*UP*UP*UP*UP*U) -3, ADENOSINE-5'-DIPHOSPHATE, ATP-DEPENDENT HELICASE NAM7, ... | Authors: | Chakrabarti, S, Jayachandran, U, Bonneau, F, Fiorini, F, Basquin, C, Domcke, S, Le Hir, H, Conti, E. | Deposit date: | 2010-11-26 | Release date: | 2011-03-30 | Last modified: | 2023-12-20 | Method: | X-RAY DIFFRACTION (2.4 Å) | Cite: | Molecular Mechanisms for the RNA-Dependent ATPase Activity of Upf1 and its Regulation by Upf2. Mol.Cell, 41, 2011
|
|
6Z18
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6z18 by Molmil](/molmil-images/mine/6z18) | Crystal structure of RNA-10mer: CCGG(N4,N4-dimethyl-C)GCCGG; R32 form | Descriptor: | RNA-10mer: CCGG(N4,N4-dimethyl-C)GCCGG | Authors: | Ruszkowski, M, Sekula, B, Mao, S, Haruehanroengra, P, Sheng, J. | Deposit date: | 2020-05-12 | Release date: | 2020-09-02 | Last modified: | 2024-05-01 | Method: | X-RAY DIFFRACTION (1.81 Å) | Cite: | Base pairing, structural and functional insights into N4-methylcytidine (m4C) and N4,N4-dimethylcytidine (m42C) modified RNA. Nucleic Acids Res., 48, 2020
|
|
6DVK
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6dvk by Molmil](/molmil-images/mine/6dvk) | Computationally designed mini tetraloop-tetraloop receptor by the RNAMake program - construct 6 (miniTTR 6) | Descriptor: | COBALT (II) ION, MAGNESIUM ION, RNA (95-MER) | Authors: | Eiler, D.R, Yesselman, J.D, Costantino, D.A, Das, R, Kieft, J.S. | Deposit date: | 2018-06-24 | Release date: | 2019-06-26 | Last modified: | 2024-03-13 | Method: | X-RAY DIFFRACTION (2.55 Å) | Cite: | Computational design of three-dimensional RNA structure and function. Nat Nanotechnol, 14, 2019
|
|