5AW8
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5aw8 by Molmil](/molmil-images/mine/5aw8) | Kinetics by X-ray crystallography: E2.MgF42-.2RB+ crystal | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, CHOLESTEROL, ... | Authors: | Ogawa, H, Cornelius, F, Hirata, A, Toyoshima, C. | Deposit date: | 2015-07-01 | Release date: | 2015-09-02 | Last modified: | 2023-11-08 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | Sequential substitution of K(+) bound to Na(+),K(+)-ATPase visualized by X-ray crystallography. Nat Commun, 6, 2015
|
|
7YSV
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7ysv by Molmil](/molmil-images/mine/7ysv) | |
1KX4
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kx4 by Molmil](/molmil-images/mine/1kx4) | X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution | Descriptor: | CHLORIDE ION, DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3'), MANGANESE (II) ION, ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2.6 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
1KX3
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kx3 by Molmil](/molmil-images/mine/1kx3) | X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution | Descriptor: | DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3'), MANGANESE (II) ION, histone H2A.1, ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
1KX5
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kx5 by Molmil](/molmil-images/mine/1kx5) | X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution | Descriptor: | CHLORIDE ION, DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3'), ... | Authors: | Davey, C.A, Sargent, D.F, Luger, K, Maeder, A.W, Richmond, T.J. | Deposit date: | 2002-01-31 | Release date: | 2002-12-25 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (1.94 Å) | Cite: | Solvent Mediated Interactions in the Structure of the Nucleosome Core Particle at 1.9 A Resolution J.Mol.Biol., 319, 2002
|
|
7D14
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7d14 by Molmil](/molmil-images/mine/7d14) | Mouse KCC2 | Descriptor: | Solute carrier family 12 member 5 | Authors: | Zhang, S, Yang, M. | Deposit date: | 2020-09-13 | Release date: | 2021-04-14 | Last modified: | 2024-05-29 | Method: | ELECTRON MICROSCOPY (3.8 Å) | Cite: | The structural basis of function and regulation of neuronal cotransporters NKCC1 and KCC2. Commun Biol, 4, 2021
|
|
7D10
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7d10 by Molmil](/molmil-images/mine/7d10) | Human NKCC1 | Descriptor: | PALMITIC ACID, Solute carrier family 12 member 2 | Authors: | Zhang, S, Yang, M. | Deposit date: | 2020-09-12 | Release date: | 2021-04-14 | Last modified: | 2024-05-29 | Method: | ELECTRON MICROSCOPY (3.52 Å) | Cite: | The structural basis of function and regulation of neuronal cotransporters NKCC1 and KCC2. Commun Biol, 4, 2021
|
|
1KOH
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1koh by Molmil](/molmil-images/mine/1koh) | THE CRYSTAL STRUCTURE AND MUTATIONAL ANALYSIS OF A NOVEL RNA-BINDING DOMAIN FOUND IN THE HUMAN TAP NUCLEAR MRNA EXPORT FACTOR | Descriptor: | TIP ASSOCIATING PROTEIN | Authors: | Ho, D.N, Coburn, G.A, Kang, Y, Cullen, B.R, Georgiadis, M.M. | Deposit date: | 2001-12-20 | Release date: | 2002-02-27 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (3.8 Å) | Cite: | The crystal structure and mutational analysis of a novel RNA-binding domain found in the human Tap nuclear mRNA export factor. Proc.Natl.Acad.Sci.USA, 99, 2002
|
|
8JFZ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8jfz by Molmil](/molmil-images/mine/8jfz) | Cryo-EM structure of Na+,K+-ATPase in the E1.Mg2+ state. | Descriptor: | 1,2-DIOLEOYL-SN-GLYCERO-3-PHOSPHOCHOLINE, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-2)-alpha-D-mannopyranose-(1-3)-[alpha-D-mannopyranose-(1-6)]beta-D-mannopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, ... | Authors: | Kanai, R, Vilsen, B, Cornelius, F, Toyoshima, C. | Deposit date: | 2023-05-19 | Release date: | 2023-08-09 | Last modified: | 2023-08-16 | Method: | ELECTRON MICROSCOPY (3.5 Å) | Cite: | Crystal structures of Na + ,K + -ATPase reveal the mechanism that converts the K + -bound form to Na + -bound form and opens and closes the cytoplasmic gate. Febs Lett., 597, 2023
|
|
2DD5
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2dd5 by Molmil](/molmil-images/mine/2dd5) | Thiocyanate hydrolase (SCNase) from Thiobacillus thioparus native holo-enzyme | Descriptor: | COBALT (III) ION, SULFATE ION, Thiocyanate hydrolase alpha subunit, ... | Authors: | Arakawa, T, Kawano, Y, Kataoka, S, Katayama, Y, Kamiya, N, Yohda, M, Odaka, M. | Deposit date: | 2006-01-19 | Release date: | 2007-01-30 | Last modified: | 2023-11-15 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Structure of thiocyanate hydrolase: a new nitrile hydratase family protein with a novel five-coordinate cobalt(III) center. J.Mol.Biol., 366, 2007
|
|
5XA4
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5xa4 by Molmil](/molmil-images/mine/5xa4) | Crystal Structure of HasAp with Fe-5,15-Diazaporphyrin | Descriptor: | 10,20-Diphenyl-5,15-diaza-porphyrin containing FE, Heme acquisition protein HasAp | Authors: | Shoji, O, Uehara, H, Sugimoto, H, Shiro, Y, Watanabe, Y. | Deposit date: | 2017-03-10 | Release date: | 2017-12-06 | Last modified: | 2023-11-22 | Method: | X-RAY DIFFRACTION (1.3 Å) | Cite: | Structures of the Heme Acquisition Protein HasA with Iron(III)-5,15-Diphenylporphyrin and Derivatives Thereof as an Artificial Prosthetic Group Angew. Chem. Int. Ed. Engl., 56, 2017
|
|
5XKB
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5xkb by Molmil](/molmil-images/mine/5xkb) | Crystal Structure of HasAp with Fe-5,15-bisethynyl-10,20-diphenylporphyrin | Descriptor: | 5,15-Bisethynyl-10,20-diphenylporphyrin containing FE, Heme acquisition protein HasAp | Authors: | Shoji, O, Uehara, H, Sugimoto, H, Shiro, Y, Watanabe, Y. | Deposit date: | 2017-05-06 | Release date: | 2017-12-06 | Last modified: | 2024-03-27 | Method: | X-RAY DIFFRACTION (1.9 Å) | Cite: | Structures of the Heme Acquisition Protein HasA with Iron(III)-5,15-Diphenylporphyrin and Derivatives Thereof as an Artificial Prosthetic Group Angew. Chem. Int. Ed. Engl., 56, 2017
|
|
2OSE
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2ose by Molmil](/molmil-images/mine/2ose) | Crystal Structure of the Mimivirus Cyclophilin | Descriptor: | CHLORIDE ION, Probable peptidyl-prolyl cis-trans isomerase | Authors: | Eisenmesser, E.Z, Thai, V, Renesto, P, Raoult, D. | Deposit date: | 2007-02-05 | Release date: | 2007-12-18 | Last modified: | 2023-08-30 | Method: | X-RAY DIFFRACTION (2.04 Å) | Cite: | Structural, biochemical, and in vivo characterization of the first virally encoded cyclophilin from the Mimivirus. J.Mol.Biol., 378, 2008
|
|
2P0V
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2p0v by Molmil](/molmil-images/mine/2p0v) | Crystal structure of BT3781 protein from Bacteroides thetaiotaomicron, Northeast Structural Genomics Target BtR58 | Descriptor: | Hypothetical protein BT3781 | Authors: | Forouhar, F, Chen, Y, Seetharaman, J, Janjua, H, Xiao, R, Liu, J, Baran, M.C, Acton, T.B, Montelione, G.T, Hunt, J.F, Tong, L, Northeast Structural Genomics Consortium (NESG) | Deposit date: | 2007-03-01 | Release date: | 2007-03-20 | Last modified: | 2017-10-18 | Method: | X-RAY DIFFRACTION (2.1 Å) | Cite: | Crystal structure of BT3781 protein from Bacteroides thetaiotaomicron. To be Published
|
|
3X2S
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 3x2s by Molmil](/molmil-images/mine/3x2s) | Crystal structure of pyrene-conjugated adenylate kinase | Descriptor: | Adenylate kinase, BIS(ADENOSINE)-5'-PENTAPHOSPHATE, MAGNESIUM ION, ... | Authors: | Fujii, A, Sekiguchi, Y, Matsumura, H, Inoue, T, Chung, W.-S, Hirota, S, Matsuo, T. | Deposit date: | 2014-12-31 | Release date: | 2015-04-01 | Last modified: | 2023-11-08 | Method: | X-RAY DIFFRACTION (2.8 Å) | Cite: | Excimer Emission Properties on Pyrene-Labeled Protein Surface: Correlation between Emission Spectra, Ring Stacking Modes, and Flexibilities of Pyrene Probes. Bioconjug.Chem., 26, 2015
|
|
1UFO
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1ufo by Molmil](/molmil-images/mine/1ufo) | Crystal Structure of TT1662 from Thermus thermophilus | Descriptor: | hypothetical protein TT1662 | Authors: | Murayama, K, Shirouzu, M, Terada, T, Kuramitsu, S, Yokoyama, S, RIKEN Structural Genomics/Proteomics Initiative (RSGI) | Deposit date: | 2003-06-03 | Release date: | 2003-12-03 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (1.6 Å) | Cite: | Crystal structure of TT1662 from Thermus thermophilus HB8: a member of the alpha/beta hydrolase fold enzymes. Proteins, 58, 2005
|
|
1KGB
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kgb by Molmil](/molmil-images/mine/1kgb) | structure of ground-state bacteriorhodopsin | Descriptor: | 1-[2,6,10.14-TETRAMETHYL-HEXADECAN-16-YL]-2-[2,10,14-TRIMETHYLHEXADECAN-16-YL]GLYCEROL, RETINAL, bacteriorhodopsin | Authors: | Facciotti, M.T, Rouhani, S, Burkard, F.T, Betancourt, F.M, Downing, K.H, Rose, R.B, McDermott, G, Glaeser, R.M. | Deposit date: | 2001-11-26 | Release date: | 2001-12-05 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (1.65 Å) | Cite: | Structure of an early intermediate in the M-state phase of the bacteriorhodopsin photocycle. Biophys.J., 81, 2001
|
|
1KG8
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kg8 by Molmil](/molmil-images/mine/1kg8) | X-ray structure of an early-M intermediate of bacteriorhodopsin | Descriptor: | 1-[2,6,10.14-TETRAMETHYL-HEXADECAN-16-YL]-2-[2,10,14-TRIMETHYLHEXADECAN-16-YL]GLYCEROL, RETINAL, bacteriorhodopsin | Authors: | Facciotti, M.T, Rouhani, S, Burkard, F.T, Betancourt, F.M, Downing, K.H, Rose, R.B, McDermott, G, Glaeser, R.M. | Deposit date: | 2001-11-26 | Release date: | 2001-12-05 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Structure of an early intermediate in the M-state phase of the bacteriorhodopsin photocycle. Biophys.J., 81, 2001
|
|
1KG9
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1kg9 by Molmil](/molmil-images/mine/1kg9) | Structure of a "mock-trapped" early-M intermediate of bacteriorhosopsin | Descriptor: | 1-[2,6,10.14-TETRAMETHYL-HEXADECAN-16-YL]-2-[2,10,14-TRIMETHYLHEXADECAN-16-YL]GLYCEROL, RETINAL, bacteriorhodopsin | Authors: | Facciotti, M.T, Rouhani, S, Burkard, F.T, Betancourt, F.M, Downing, K.H, Rose, R.B, McDermott, G, Glaeser, R.M. | Deposit date: | 2001-11-26 | Release date: | 2001-12-05 | Last modified: | 2023-08-16 | Method: | X-RAY DIFFRACTION (1.81 Å) | Cite: | Structure of an early intermediate in the M-state phase of the bacteriorhodopsin photocycle. Biophys.J., 81, 2001
|
|
4MLD
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4mld by Molmil](/molmil-images/mine/4mld) | X-ray structure of ComE D58E REC domain from Streptococcus pneumoniae | Descriptor: | Response regulator | Authors: | Boudes, M, Sanchez, D, Durand, D, Graille, M, van Tilbeurgh, H, Quevillon-Cheruel, S. | Deposit date: | 2013-09-06 | Release date: | 2014-02-19 | Last modified: | 2023-09-20 | Method: | X-RAY DIFFRACTION (2.88 Å) | Cite: | Structural insights into the dimerization of the response regulator ComE from Streptococcus pneumoniae. Nucleic Acids Res., 42, 2014
|
|
7YTB
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7ytb by Molmil](/molmil-images/mine/7ytb) | Crystal structure of Kin4B8 | Descriptor: | (2R)-2,3-dihydroxypropyl (9Z)-octadec-9-enoate, Kin4B8, RETINAL | Authors: | Murakoshi, S, Chazan, A, Shihoya, W, Beja, O, Nureki, O. | Deposit date: | 2022-08-14 | Release date: | 2023-03-15 | Last modified: | 2023-03-29 | Method: | X-RAY DIFFRACTION (3 Å) | Cite: | Phototrophy by antenna-containing rhodopsin pumps in aquatic environments. Nature, 615, 2023
|
|
8C7B
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8c7b by Molmil](/molmil-images/mine/8c7b) | |
4W8L
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4w8l by Molmil](/molmil-images/mine/4w8l) | Structure of GH10 from Paenibacillus barcinonensis | Descriptor: | CALCIUM ION, Endo-1,4-beta-xylanase C, GLYCEROL | Authors: | Sainz-Polo, M.A, Sanz-Aparicio, J. | Deposit date: | 2014-08-25 | Release date: | 2015-06-03 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (1.76 Å) | Cite: | Exploring Multimodularity in Plant Cell Wall Deconstruction: STRUCTURAL AND FUNCTIONAL ANALYSIS OF Xyn10C CONTAINING THE CBM22-1-CBM22-2 TANDEM. J.Biol.Chem., 290, 2015
|
|
8BHG
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8bhg by Molmil](/molmil-images/mine/8bhg) | GABA-A receptor a5 heteromer - a5V2 - Bretazenil | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, Bretazenil, DECYL-BETA-D-MALTOPYRANOSIDE, ... | Authors: | Miller, P.S, Malinauskas, T.M, Omari, K.E, Aricescu, A.R. | Deposit date: | 2022-10-31 | Release date: | 2023-11-15 | Last modified: | 2023-12-27 | Method: | X-RAY DIFFRACTION (2.39 Å) | Cite: | The molecular basis of drug selectivity for alpha 5 subunit-containing GABA A receptors. Nat.Struct.Mol.Biol., 30, 2023
|
|
7N3N
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7n3n by Molmil](/molmil-images/mine/7n3n) | CryoEM structure of human NKCC1 state Fu-I | Descriptor: | 5-(AMINOSULFONYL)-4-CHLORO-2-[(2-FURYLMETHYL)AMINO]BENZOIC ACID, Solute carrier family 12 member 2 | Authors: | Moseng, M.A. | Deposit date: | 2021-06-01 | Release date: | 2022-09-28 | Last modified: | 2023-05-31 | Method: | ELECTRON MICROSCOPY (3.33 Å) | Cite: | Inhibition mechanism of NKCC1 involves the carboxyl terminus and long-range conformational coupling. Sci Adv, 8, 2022
|
|