4WQF
 
 | | Crystal structure of the Thermus thermophilus 70S ribosome in complex with elongation factor G and fusidic acid in the post-translocational state | | Descriptor: | 16S Ribosomal RNA, 23S Ribosomal RNA, 30S ribosomal protein S10, ... | | Authors: | Lin, J, Gagnon, M.G, Steitz, T.A. | | Deposit date: | 2014-10-21 | | Release date: | 2015-01-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Conformational Changes of Elongation Factor G on the Ribosome during tRNA Translocation.
Cell, 160, 2015
|
|
4WQY
 | | Crystal structure of the Thermus thermophilus 70S ribosome in complex with elongation factor G in the post-translocational state (without fusitic acid) | | Descriptor: | 16S Ribosomal RNA, 23S Ribosomal RNA, 30S ribosomal protein S10, ... | | Authors: | Lin, J, Gagnon, M.G, Steitz, T.A. | | Deposit date: | 2014-10-22 | | Release date: | 2015-01-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Conformational Changes of Elongation Factor G on the Ribosome during tRNA Translocation.
Cell, 160, 2015
|
|
4WPO
 | | Crystal structure of the Thermus thermophilus 70S ribosome in complex with elongation factor G in the pre-translocational state | | Descriptor: | 16S Ribosomal RNA, 23S Ribosomal RNA, 30S ribosomal protein S10, ... | | Authors: | Lin, J, Gagnon, M.G, Steitz, T.A. | | Deposit date: | 2014-10-20 | | Release date: | 2015-01-28 | | Last modified: | 2023-12-27 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Conformational Changes of Elongation Factor G on the Ribosome during tRNA Translocation.
Cell, 160, 2015
|
|
4Z8C
 | | Crystal structure of the Thermus thermophilus 70S ribosome bound to translation inhibitor oncocin | | Descriptor: | 16S ribosomal RNA, 23S ribosomal RNA, 30S ribosomal protein S10, ... | | Authors: | Roy, R.N, Lomakin, I.B, Gagnon, M.G, Steitz, T.A. | | Deposit date: | 2015-04-08 | | Release date: | 2015-05-20 | | Last modified: | 2024-03-06 | | Method: | X-RAY DIFFRACTION (2.9 Å) | | Cite: | The mechanism of inhibition of protein synthesis by the proline-rich peptide oncocin.
Nat.Struct.Mol.Biol., 22, 2015
|
|
4Z3S
 | | Crystal structure of the Thermus thermophilus 70S ribosome in complex with antibiotic A201A, mRNA and three tRNAs in the A, P and E sites at 2.65A resolution | | Descriptor: | 16S Ribosomal RNA, 23S Ribosomal RNA, 3'-deoxy-3'-{[(2E)-3-(4-{[(4Z)-6-O-(6-deoxy-3,4-di-O-methyl-alpha-D-mannopyranosyl)-5-O-methyl-alpha-D-threo-hex-4-enofuranosyl]oxy}phenyl)-2-methylprop-2-enoyl]amino}-N,N-dimethyladenosine, ... | | Authors: | Polikanov, Y.S, Starosta, A.L, Juette, M.F, Altman, R.B, Terry, D.S, Lu, W, Burnett, B.J, Dinos, G, Reynolds, K, Blanchard, S.C, Steitz, T.A, Wilson, D.N. | | Deposit date: | 2015-03-31 | | Release date: | 2015-06-03 | | Last modified: | 2023-11-15 | | Method: | X-RAY DIFFRACTION (2.65 Å) | | Cite: | Distinct tRNA Accommodation Intermediates Observed on the Ribosome with the Antibiotics Hygromycin A and A201A.
Mol.Cell, 58, 2015
|
|
4KJZ
 | |
4KZX
 | | Rabbit 40S ribosomal subunit in complex with eIF1. | | Descriptor: | 18S ribosomal RNA, 40S Ribosomal protein S9, 40S ribosomal protein RACK1, ... | | Authors: | Lomakin, I.B, Steitz, T.A. | | Deposit date: | 2013-05-30 | | Release date: | 2013-07-24 | | Last modified: | 2023-09-20 | | Method: | X-RAY DIFFRACTION (7.809 Å) | | Cite: | The initiation of mammalian protein synthesis and mRNA scanning mechanism.
Nature, 500, 2013
|
|
4KZY
 | |
1FFK
 | | CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM HALOARCULA MARISMORTUI AT 2.4 ANGSTROM RESOLUTION | | Descriptor: | 23S RRNA, 5S RRNA, CADMIUM ION, ... | | Authors: | Ban, N, Nissen, P, Hansen, J, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-25 | | Release date: | 2000-08-14 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | The complete atomic structure of the large ribosomal subunit at 2.4 A resolution.
Science, 289, 2000
|
|
1GDR
 | |
1HKG
 | |
2EFG
 | | TRANSLATIONAL ELONGATION FACTOR G COMPLEXED WITH GDP | | Descriptor: | GUANOSINE-5'-DIPHOSPHATE, PROTEIN (ELONGATION FACTOR G DOMAIN 3), PROTEIN (ELONGATION FACTOR G) | | Authors: | Czworkowski, J, Wang, J, Steitz, T.A, Moore, P.B. | | Deposit date: | 1998-09-23 | | Release date: | 1999-09-30 | | Last modified: | 2023-08-23 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | The crystal structure of elongation factor G complexed with GDP, at 2.7 A resolution.
EMBO J., 13, 1994
|
|
2EX3
 | | Bacteriophage phi29 DNA polymerase bound to terminal protein | | Descriptor: | DNA polymerase, DNA terminal protein, LEAD (II) ION | | Authors: | Kamtekar, S, Berman, A.J, Wang, J, de Vega, M, Blanco, L, Salas, M, Steitz, T.A. | | Deposit date: | 2005-11-07 | | Release date: | 2006-03-14 | | Last modified: | 2024-04-03 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The phi29 DNA polymerase:protein-primer structure suggests a model for the initiation to elongation transition
Embo J., 25, 2006
|
|
2FOT
 | | Crystal structure of the complex between calmodulin and alphaII-spectrin | | Descriptor: | CALCIUM ION, Calmodulin, alpha-II spectrin Spectrin | | Authors: | Simonovic, M, Zhang, Z, Cianci, C.D, Steitz, T.A, Morrow, J.S. | | Deposit date: | 2006-01-13 | | Release date: | 2006-09-05 | | Last modified: | 2023-08-30 | | Method: | X-RAY DIFFRACTION (2.45 Å) | | Cite: | Structure of the calmodulin alphaII-spectrin complex provides insight into the regulation of cell plasticity.
J.Biol.Chem., 281, 2006
|
|
1FG0
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
1FFZ
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH R(CC)-DA-PUROMYCIN | | Descriptor: | 23S RIBOSOMAL RNA, R(P*CP*C*)-D(P*A)-R(P*(PU)) | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3.2 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
1XI1
 | | Phi29 DNA polymerase ssDNA complex, monoclinic crystal form | | Descriptor: | 5'-D(P*TP*TP*TP*TP*T)-3', DNA polymerase, MAGNESIUM ION | | Authors: | Kamtekar, S, Berman, A.J, Wang, J, Lazaro, J.M, de Vega, M, Blanco, L, Salas, M, Steitz, T.A. | | Deposit date: | 2004-09-21 | | Release date: | 2004-12-07 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.2 Å) | | Cite: | Correction of X-ray intensities from single crystals containing lattice-translocation defects
Acta Crystallogr.,Sect.D, 61, 2005
|
|
1XHX
 | | Phi29 DNA Polymerase, orthorhombic crystal form | | Descriptor: | DNA polymerase, MAGNESIUM ION, SULFATE ION | | Authors: | Kamtekar, S, Berman, A.J, Wang, J, Lazaro, J.M, de Vega, M, Blanco, L, Salas, M, Steitz, T.A. | | Deposit date: | 2004-09-21 | | Release date: | 2004-12-07 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.35 Å) | | Cite: | Insights into Strand Displacement and Processivity from the Crystal Structure of the Protein-Primed DNA Polymerase of Bacteriophage phi29
Mol.Cell, 16, 2004
|
|
2HPI
 | | Eubacterial and Eukaryotic Replicative DNA Polymerases are not Homologous: X-ray Structure of DNA Polymerase III | | Descriptor: | CHLORIDE ION, DNA polymerase III alpha subunit, MAGNESIUM ION, ... | | Authors: | Bailey, S, Wing, R.A, Steitz, T.A. | | Deposit date: | 2006-07-17 | | Release date: | 2006-09-19 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The Structure of T. aquaticus DNA Polymerase III Is Distinct from Eukaryotic Replicative DNA Polymerases.
Cell(Cambridge,Mass.), 126, 2006
|
|
1XHZ
 | | Phi29 DNA polymerase, orthorhombic crystal form, ssDNA complex | | Descriptor: | 5'-D(*TP*TP*TP*TP*T)-3', DNA polymerase | | Authors: | Kamtekar, S, Berman, A.J, Wang, J, Lazaro, J.M, de Vega, M, Blanco, L, Salas, M, Steitz, T.A. | | Deposit date: | 2004-09-21 | | Release date: | 2004-12-07 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (2.7 Å) | | Cite: | Insights into Strand Displacement and Processivity from the Crystal Structure of the Protein-Primed DNA Polymerase of Bacteriophage phi29
Mol.Cell, 16, 2004
|
|
1GSG
 | | Structure of E.coli glutaminyl-tRNA synthetase complexed with trnagln and ATP at 2.8 Angstroms resolution | | Descriptor: | GLUTAMINYL-TRNA SYNTHETASE, TRNAGLN | | Authors: | Rould, M.A, Perona, J.J, Soell, D, Steitz, T.A. | | Deposit date: | 1990-04-03 | | Release date: | 1992-02-24 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Structure of E. coli glutaminyl-tRNA synthetase complexed with tRNA(Gln) and ATP at 2.8 A resolution.
Science, 246, 1989
|
|
2HPM
 | | Eubacterial and Eukaryotic Replicative DNA Polymerases are not Homologous: X-ray Structure of DNA Polymerase III | | Descriptor: | CHLORIDE ION, DNA Polymerase III alpha subunit, MAGNESIUM ION, ... | | Authors: | Bailey, S, Wing, R.A, Steitz, T.A. | | Deposit date: | 2006-07-17 | | Release date: | 2006-09-19 | | Last modified: | 2024-02-14 | | Method: | X-RAY DIFFRACTION (3.7 Å) | | Cite: | The Structure of T. aquaticus DNA Polymerase III Is Distinct from Eukaryotic Replicative DNA Polymerases.
Cell(Cambridge,Mass.), 126, 2006
|
|
2REB
 | |
6UTV
 | | E. coli sigma-S transcription initiation complex with a 6-nt RNA ("Fresh" crystal soaked with CTP, UTP, GTP, and ddATP for 150 seconds) | | Descriptor: | DIPHOSPHATE, DNA-directed RNA polymerase subunit alpha, DNA-directed RNA polymerase subunit beta, ... | | Authors: | Zuo, Y, De, S, Steitz, T.A. | | Deposit date: | 2019-10-30 | | Release date: | 2020-08-26 | | Last modified: | 2023-10-11 | | Method: | X-RAY DIFFRACTION (3.45 Å) | | Cite: | Structural Insights into Transcription Initiation from De Novo RNA Synthesis to Transitioning into Elongation.
Iscience, 23, 2020
|
|
6UUA
 | | E. coli sigma-S transcription initiation complex with a mismatching CTP ("Fresh" crystal soaked with CTP for 2 hours) | | Descriptor: | CYTIDINE-5'-TRIPHOSPHATE, DNA-directed RNA polymerase subunit alpha, DNA-directed RNA polymerase subunit beta, ... | | Authors: | Zuo, Y, De, S, Steitz, T.A. | | Deposit date: | 2019-10-30 | | Release date: | 2020-08-26 | | Last modified: | 2023-10-11 | | Method: | X-RAY DIFFRACTION (4.002 Å) | | Cite: | Structural Insights into Transcription Initiation from De Novo RNA Synthesis to Transitioning into Elongation.
Iscience, 23, 2020
|
|
