7OW8
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7ow8 by Molmil](/molmil-images/mine/7ow8) | CryoEM structure of the ABC transporter BmrA E504A mutant in complex with ATP-Mg | Descriptor: | ADENOSINE-5'-TRIPHOSPHATE, MAGNESIUM ION, Multidrug resistance ABC transporter ATP-binding/permease protein BmrA | Authors: | Gobet, A, Schoehn, G, Falson, P, Chaptal, V. | Deposit date: | 2021-06-17 | Release date: | 2022-01-19 | Last modified: | 2022-02-02 | Method: | ELECTRON MICROSCOPY (3.5 Å) | Cite: | Substrate-bound and substrate-free outward-facing structures of a multidrug ABC exporter. Sci Adv, 8, 2022
|
|
5DZP
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5dzp by Molmil](/molmil-images/mine/5dzp) | Crystal structure of Mycobacterium tuberculosis L,D-transpeptidase 2 with carbapenem drug T206 in conformation B | Descriptor: | (2~{R},3~{R},4~{R})-4-methyl-3-(2-oxidanylidene-2-propoxy-ethyl)sulfanyl-5-[(2~{S},3~{R})-3-oxidanyl-1-oxidanylidene-butan-2-yl]-3,4-dihydro-2~{H}-pyrrole-2-carboxylic acid, L,D-transpeptidase 2 | Authors: | Kumar, P, Ginell, S.L, Lamichhane, G. | Deposit date: | 2015-09-25 | Release date: | 2016-10-05 | Last modified: | 2023-09-27 | Method: | X-RAY DIFFRACTION (2.19 Å) | Cite: | Non-classical transpeptidases yield insight into new antibacterials. Nat. Chem. Biol., 13, 2017
|
|
4CQL
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4cql by Molmil](/molmil-images/mine/4cql) | Crystal structure of heterotetrameric human ketoacyl reductase complexed with NAD | Descriptor: | CARBONYL REDUCTASE FAMILY MEMBER 4, ESTRADIOL 17-BETA-DEHYDROGENASE 8, NICOTINAMIDE-ADENINE-DINUCLEOTIDE | Authors: | Venkatesan, R, Sah-Teli, S.K, Awoniyi, L.O, Jiang, G, Prus, P, Kastaniotis, A.J, Hiltunen, J.K, Wierenga, R.K, Chen, Z. | Deposit date: | 2014-02-19 | Release date: | 2014-09-10 | Last modified: | 2023-12-20 | Method: | X-RAY DIFFRACTION (2.85 Å) | Cite: | Insights Into Mitochondrial Fatty Acid Synthesis from the Structure of Heterotetrameric 3-Ketoacyl-Acp Reductase/3R-Hydroxyacyl-Coa Dehydrogenase. Nat.Commun., 5, 2014
|
|
8TGP
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 8tgp by Molmil](/molmil-images/mine/8tgp) | |
7Z45
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7z45 by Molmil](/molmil-images/mine/7z45) | Central part (C10) of bacteriophage SU10 capsid | Descriptor: | Major head protein | Authors: | Siborova, M, Fuzik, T, Prochazkova, M, Novacek, J, Plevka, P. | Deposit date: | 2022-03-03 | Release date: | 2022-08-24 | Last modified: | 2022-10-12 | Method: | ELECTRON MICROSCOPY (3.5 Å) | Cite: | Tail proteins of phage SU10 reorganize into the nozzle for genome delivery. Nat Commun, 13, 2022
|
|
5HMM
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5hmm by Molmil](/molmil-images/mine/5hmm) | Crystal Structure of T5 D15 Protein Co-crystallized with Metal Ions | Descriptor: | 1,2-ETHANEDIOL, CHLORIDE ION, Exodeoxyribonuclease, ... | Authors: | Flemming, C.S, Sedelnikova, S.E, Rafferty, J.B, Sayers, J.R, Artymiuk, P.J. | Deposit date: | 2016-01-16 | Release date: | 2016-06-01 | Last modified: | 2024-01-10 | Method: | X-RAY DIFFRACTION (1.5 Å) | Cite: | Direct observation of DNA threading in flap endonuclease complexes. Nat.Struct.Mol.Biol., 23, 2016
|
|
4CXG
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4cxg by Molmil](/molmil-images/mine/4cxg) | Regulation of the mammalian elongation cycle by 40S subunit rolling: a eukaryotic-specific ribosome rearrangement | Descriptor: | 18S RRNA - H44, 18S RRNA - H5-H14, 18S RRNA - H8, ... | Authors: | Budkevich, T.V, Giesebrecht, J, Behrmann, E, Loerke, J, Ramrath, D.J.F, Mielke, T, Ismer, J, Hildebrand, P, Tung, C.-S, Nierhaus, K.H, Sanbonmatsu, K.Y, Spahn, C.M.T. | Deposit date: | 2014-04-07 | Release date: | 2014-07-16 | Last modified: | 2024-05-08 | Method: | ELECTRON MICROSCOPY (8.7 Å) | Cite: | Regulation of the Mammalian Elongation Cycle by Subunit Rolling: A Eukaryotic-Specific Ribosome Rearrangement. Cell(Cambridge,Mass.), 158, 2014
|
|
4CQX
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4cqx by Molmil](/molmil-images/mine/4cqx) | H5 (tyTy) Del133/Ile155Thr Mutant Haemagglutinin in Complex with Human Receptor Analogue 6'SLN | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, HAEMAGGLUTININ HA1, HAEMAGGLUTININ HA2, ... | Authors: | Xiong, X, Xiao, H, Martin, S.R, Coombs, P.J, Liu, J, Collins, P.J, Vachieri, S.G, Walker, P.A, Lin, Y.P, McCauley, J.W, Gamblin, S.J, Skehel, J.J. | Deposit date: | 2014-02-21 | Release date: | 2014-05-28 | Last modified: | 2023-12-20 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | Enhanced Human Receptor Binding by H5 Haemagglutinins. Virology, 456, 2014
|
|
6EBS
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6ebs by Molmil](/molmil-images/mine/6ebs) | Crystal structure of Leishmania major dihydroorotate dehydrogenase mutant H174A in complex with orotate | Descriptor: | Dihydroorotate dehydrogenase (fumarate), FLAVIN MONONUCLEOTIDE, GLYCEROL, ... | Authors: | Reis, R.A.G, Pinheiro, M.P, de Souza, A.L, Hunter, W.N, Nonato, M.C. | Deposit date: | 2018-08-07 | Release date: | 2019-08-21 | Last modified: | 2023-10-11 | Method: | X-RAY DIFFRACTION (2.05 Å) | Cite: | Crystal structure of Leishmania major dihydroorotate dehydrogenase mutant H174A in complex with orotate To Be Published
|
|
6UID
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6uid by Molmil](/molmil-images/mine/6uid) | |
2JIY
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 2jiy by Molmil](/molmil-images/mine/2jiy) | PHOTOSYNTHETIC REACTION CENTER MUTANT WITH ALA M149 REPLACED WITH TRP (CHAIN M, AM149W) | Descriptor: | BACTERIOCHLOROPHYLL A, BACTERIOPHEOPHYTIN A, CARDIOLIPIN, ... | Authors: | Fyfe, P.K, Potter, J.A, Cheng, J, Williams, C.M, Watson, A.J, Jones, M.R. | Deposit date: | 2007-07-03 | Release date: | 2007-09-04 | Last modified: | 2024-05-01 | Method: | X-RAY DIFFRACTION (2.2 Å) | Cite: | Structural Responses to Cavity-Creating Mutations in an Integral Membrane Protein. Biochemistry, 46, 2007
|
|
4KFN
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4kfn by Molmil](/molmil-images/mine/4kfn) | Structure-Based Discovery of Novel Amide-Containing Nicotinamide Phosphoribosyltransferase (Nampt) Inhibitors | Descriptor: | 1,2-ETHANEDIOL, N-[4-(piperidin-1-ylsulfonyl)benzyl]-1H-pyrrolo[3,2-c]pyridine-2-carboxamide, Nicotinamide phosphoribosyltransferase, ... | Authors: | Zheng, X, Bauer, P, Baumeister, T, Buckmelter, A.J, Caligiuri, M, Clodfelter, K.H, Han, B, Ho, Y, Kley, N, Lin, J, Reynolds, D.J, Sharma, G, Smith, C.C, Wang, Z, Dragovich, P.S, Gunzner-Toste, J, Liederer, B.M, Ly, J, O'Brien, T, Oh, A, Wang, L, Wang, W, Xiao, Y, Zak, M, Zhao, G, Yuen, P, Bair, K.W. | Deposit date: | 2013-04-27 | Release date: | 2013-05-08 | Last modified: | 2024-02-28 | Method: | X-RAY DIFFRACTION (1.6 Å) | Cite: | Structure-based identification of ureas as novel nicotinamide phosphoribosyltransferase (nampt) inhibitors. J.Med.Chem., 56, 2013
|
|
7Z21
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7z21 by Molmil](/molmil-images/mine/7z21) | BAF A12T bound to the lamin A/C Ig-fold domain | Descriptor: | Barrier-to-autointegration factor, N-terminally processed, CHLORIDE ION, ... | Authors: | Marcelot, A, Legrand, P, Zinn-Justin, S. | Deposit date: | 2022-02-25 | Release date: | 2022-08-24 | Last modified: | 2024-01-31 | Method: | X-RAY DIFFRACTION (1.629 Å) | Cite: | The BAF A12T mutation disrupts lamin A/C interaction, impairing robust repair of nuclear envelope ruptures in Nestor-Guillermo progeria syndrome cells. Nucleic Acids Res., 50, 2022
|
|
7VY3
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7vy3 by Molmil](/molmil-images/mine/7vy3) | STRUCTURE OF PHOTOSYNTHETIC LH1-RC SUPER-COMPLEX OF RHODOBACTER SPHAEROIDES LACKING PROTEIN-U | Descriptor: | (1R)-2-{[{[(2S)-2,3-DIHYDROXYPROPYL]OXY}(HYDROXY)PHOSPHORYL]OXY}-1-[(PALMITOYLOXY)METHYL]ETHYL (11E)-OCTADEC-11-ENOATE, Antenna pigment protein alpha chain, Antenna pigment protein beta chain, ... | Authors: | Tani, K, Kanno, R, Kawamura, S, Kikuchi, R, Nagashima, K.V.P, Hall, M, Takahashi, A, Yu, L.-J, Kimura, Y, Madigan, M.T, Mizoguchi, A, Humbel, B.M, Wang-Otomo, Z.-Y. | Deposit date: | 2021-11-13 | Release date: | 2022-04-27 | Method: | ELECTRON MICROSCOPY (2.63 Å) | Cite: | Asymmetric structure of the native Rhodobacter sphaeroides dimeric LH1-RC complex. Nat Commun, 13, 2022
|
|
1A9I
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1a9i by Molmil](/molmil-images/mine/1a9i) | |
6EHA
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6eha by Molmil](/molmil-images/mine/6eha) | Heme oxygenase 1 in complex with inhibitor | Descriptor: | 1-(3-imidazol-1-ylpropyl)-5-(2-methylpropyl)-4-phenyl-imidazole, Heme oxygenase 1, PROTOPORPHYRIN IX CONTAINING FE | Authors: | Grudnik, P, Mieczkowski, M. | Deposit date: | 2017-09-12 | Release date: | 2018-10-10 | Last modified: | 2024-05-08 | Method: | X-RAY DIFFRACTION (2 Å) | Cite: | Development and characterization of a new inhibitor of heme oxygenase activity for cancer treatment. Arch.Biochem.Biophys., 671, 2019
|
|
1EIS
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1eis by Molmil](/molmil-images/mine/1eis) | UDA UNCOMPLEXED FORM. CRYSTAL STRUCTURE OF URTICA DIOICA AGGLUTININ, A SUPERANTIGEN PRESENTED BY MHC MOLECULES OF CLASS I AND CLASS II | Descriptor: | PROTEIN (AGGLUTININ ISOLECTIN VI/AGGLUTININ ISOLECTIN V) | Authors: | Saul, F.A, Rovira, P, Boulot, G, Van Damme, E.J.M, Peumans, W.J, Truffa-Bachi, P, Bentley, G.A. | Deposit date: | 2000-02-28 | Release date: | 2000-06-21 | Last modified: | 2019-12-25 | Method: | X-RAY DIFFRACTION (1.66 Å) | Cite: | Crystal structure of Urtica dioica agglutinin, a superantigen presented by MHC molecules of class I and class II. Structure Fold.Des., 8, 2000
|
|
6AEZ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6aez by Molmil](/molmil-images/mine/6aez) | Crystal structure of human CCL5 trimer | Descriptor: | C-C motif chemokine 5, SULFATE ION | Authors: | Chen, Y.C, Li, K.M, Chen, P.J, Zarivach, R, Sun, Y.J, Sue, S.C. | Deposit date: | 2018-08-07 | Release date: | 2019-08-07 | Last modified: | 2023-11-22 | Method: | X-RAY DIFFRACTION (1.63 Å) | Cite: | Integrative Model to Coordinate the Oligomerization and Aggregation Mechanisms of CCL5. J.Mol.Biol., 432, 2020
|
|
4CQW
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 4cqw by Molmil](/molmil-images/mine/4cqw) | H5 (tyTy) Del133/Ile155Thr Mutant Haemagglutinin in Complex with Avian Receptor Analogue 3'SLN | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, HAEMAGGLUTININ HA1, HAEMAGGLUTININ HA2, ... | Authors: | Xiong, X, Xiao, H, Martin, S.R, Coombs, P.J, Liu, J, Collins, P.J, Vachieri, S.G, Walker, P.A, Lin, Y.P, McCauley, J.W, Gamblin, S.J, Skehel, J.J. | Deposit date: | 2014-02-21 | Release date: | 2014-05-28 | Last modified: | 2023-12-20 | Method: | X-RAY DIFFRACTION (2.3 Å) | Cite: | Enhanced Human Receptor Binding by H5 Haemagglutinins. Virology, 456, 2014
|
|
1AO9
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1ao9 by Molmil](/molmil-images/mine/1ao9) | |
1RAQ
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 1raq by Molmil](/molmil-images/mine/1raq) | |
6U1N
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 6u1n by Molmil](/molmil-images/mine/6u1n) | GPCR-Beta arrestin structure in lipid bilayer | Descriptor: | 3-amino-5-chloro-N-cyclopropyl-4-methyl-6-[2-(4-methylpiperazin-1-yl)-2-oxoethoxy]thieno[2,3-b]pyridine-2-carboxamide, Beta-arrestin-1, Fab30 heavy chain, ... | Authors: | Staus, D.P, Hu, H, Robertson, M.J, Kleinhenz, A.L.W, Wingler, L.M, Capel, W.D, Latorraca, N.R, Lefkowitz, R.J, Skiniotis, G. | Deposit date: | 2019-08-16 | Release date: | 2020-02-26 | Last modified: | 2020-03-25 | Method: | ELECTRON MICROSCOPY (4 Å) | Cite: | Structure of the M2 muscarinic receptor-beta-arrestin complex in a lipid nanodisc. Nature, 579, 2020
|
|
7Z9L
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7z9l by Molmil](/molmil-images/mine/7z9l) | Phen-DC3 intercalation causes hybrid-to-antiparallel transformation of human telomeric DNA G-quadruplex | Descriptor: | DNA (5'-D(*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*G)-3'), N2,N9-bis(1-methylquinolin-3-yl)-1,10-phenanthroline-2,9-dicarboxamide | Authors: | Ghosh, A, Trajkovski, M, Teulade-Fichou, M.P, Gabelica, V, Plavec, J. | Deposit date: | 2022-03-21 | Release date: | 2022-08-31 | Last modified: | 2024-05-15 | Method: | SOLUTION NMR | Cite: | Phen-DC 3 Induces Refolding of Human Telomeric DNA into a Chair-Type Antiparallel G-Quadruplex through Ligand Intercalation. Angew.Chem.Int.Ed.Engl., 61, 2022
|
|
7OY5
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 7oy5 by Molmil](/molmil-images/mine/7oy5) | Crystal structure of GSK3Beta in complex with ARN25068 | Descriptor: | CHLORIDE ION, Glycogen synthase kinase-3 beta, ~{N}4-(3-cyclopropyl-1~{H}-pyrazol-5-yl)-~{N}2-(phenylmethyl)thieno[3,2-d]pyrimidine-2,4-diamine | Authors: | Tripathi, S.K, Balboni, B, Demuro, S, DiMartino, R, Giabbai, B, Storici, P, Ortega, J, Girotto, S, Cavalli, A. | Deposit date: | 2021-06-23 | Release date: | 2022-03-02 | Last modified: | 2024-01-31 | Method: | X-RAY DIFFRACTION (2.57 Å) | Cite: | ARN25068, a versatile starting point towards triple GSK-3 beta /FYN/DYRK1A inhibitors to tackle tau-related neurological disorders. Eur.J.Med.Chem., 229, 2022
|
|
5E3M
![Download](/newweb/media/icons/dl.png) ![Visualize](/newweb/media/icons/hoh_3d.png)
![BU of 5e3m by Molmil](/molmil-images/mine/5e3m) | Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) | Descriptor: | DNA (27-MER), DNA-binding protein Fis | Authors: | Stella, S, Hancock, S.P, Cascio, D, Johnson, R.C. | Deposit date: | 2015-10-03 | Release date: | 2016-03-09 | Last modified: | 2024-05-22 | Method: | X-RAY DIFFRACTION (2.886 Å) | Cite: | DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis. Plos One, 11, 2016
|
|