7TYO
 
 | | Calcitonin receptor in complex with Gs and human calcitonin peptide | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, CHOLESTEROL HEMISUCCINATE, Calcitonin, ... | | Authors: | Cao, J, Belousoff, M.J, Johnson, R.M, Wootten, D.L, Sexton, P.M. | | Deposit date: | 2022-02-14 | | Release date: | 2022-03-23 | | Last modified: | 2022-04-06 | | Method: | ELECTRON MICROSCOPY (2.7 Å) | | Cite: | A structural basis for amylin receptor phenotype.
Science, 375, 2022
|
|
7TYW
 | | Human Amylin1 Receptor in complex with Gs and salmon calcitonin peptide | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, CHOLESTEROL HEMISUCCINATE, Calcitonin receptor, ... | | Authors: | Cao, J, Belousoff, M.J, Johnson, R.M, Wootten, D.L, Sexton, P.M. | | Deposit date: | 2022-02-14 | | Release date: | 2022-03-23 | | Last modified: | 2022-04-06 | | Method: | ELECTRON MICROSCOPY (3 Å) | | Cite: | A structural basis for amylin receptor phenotype.
Science, 375, 2022
|
|
4PTF
 | | Ternary crystal structure of yeast DNA polymerase epsilon with template G | | Descriptor: | 1,2-ETHANEDIOL, 2'-DEOXYCYTIDINE-5'-TRIPHOSPHATE, 5'-D(*AP*TP*CP*CP*TP*CP*CP*CP*CP*TP*AP*(DOC))-3', ... | | Authors: | Jain, R, Rajashankar, K.R, Buku, A, Johnson, R.E, Prakash, L, Prakash, S, Aggarwal, A.K. | | Deposit date: | 2014-03-10 | | Release date: | 2014-04-30 | | Last modified: | 2023-09-20 | | Method: | X-RAY DIFFRACTION (2.809 Å) | | Cite: | Crystal Structure of Yeast DNA Polymerase epsilon Catalytic Domain.
Plos One, 9, 2014
|
|
4IHY
 | |
4IHW
 | |
4IHX
 | |
4IHV
 | |
3PZP
 | | Human DNA polymerase kappa extending opposite a cis-syn thymine dimer | | Descriptor: | 2'-DEOXYADENOSINE 5'-TRIPHOSPHATE, 5'-D(*GP*GP*GP*GP*GP*AP*AP*GP*GP*AP*CP*CP*A)-3', 5'-D(*TP*TP*CP*CP*(TTD)P*GP*GP*TP*CP*CP*TP*TP*CP*CP*CP*CP*C)-3', ... | | Authors: | Vasquez-Del Carpio, R, Silverstein, T.D, Lone, S, Johnson, R.E, Prakash, S, Prakash, L, Aggarwal, A.K. | | Deposit date: | 2010-12-14 | | Release date: | 2011-12-28 | | Last modified: | 2023-09-13 | | Method: | X-RAY DIFFRACTION (3.336 Å) | | Cite: | Role of human DNA polymerase kappa in extension opposite from a cis-syn thymine dimer.
J.Mol.Biol., 408, 2011
|
|
5DTD
 | |
5E3L
 | |
5DS9
 | |
5E3O
 | |
5E3N
 | |
5E3M
 | | Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT) | | Descriptor: | DNA (27-MER), DNA-binding protein Fis | | Authors: | Stella, S, Hancock, S.P, Cascio, D, Johnson, R.C. | | Deposit date: | 2015-10-03 | | Release date: | 2016-03-09 | | Last modified: | 2024-05-22 | | Method: | X-RAY DIFFRACTION (2.886 Å) | | Cite: | DNA Sequence Determinants Controlling Affinity, Stability and Shape of DNA Complexes Bound by the Nucleoid Protein Fis.
Plos One, 11, 2016
|
|
6QQ6
 | | Cryo-EM structure of dimeric quinol dependent nitric oxide reductase (qNOR) Val495Ala mutant from Alcaligenes xylosoxidans | | Descriptor: | (1R)-2-{[(R)-(2-AMINOETHOXY)(HYDROXY)PHOSPHORYL]OXY}-1-[(DODECANOYLOXY)METHYL]ETHYL (9Z)-OCTADEC-9-ENOATE, CALCIUM ION, DODECYL-BETA-D-MALTOSIDE, ... | | Authors: | Gopalasingam, C.C, Johnson, R.M, Chiduza, G.N, Tosha, T, Yamamoto, M, Shiro, Y, Antonyuk, S.V, Muench, S.P, Hasnain, S.S. | | Deposit date: | 2019-02-17 | | Release date: | 2019-09-11 | | Last modified: | 2024-05-15 | | Method: | ELECTRON MICROSCOPY (3.3 Å) | | Cite: | Dimeric structures of quinol-dependent nitric oxide reductases (qNORs) revealed by cryo-electron microscopy.
Sci Adv, 5, 2019
|
|
5FLZ
 | | Cryo-EM structure of gamma-TuSC oligomers in a closed conformation | | Descriptor: | SPINDLE POLE BODY COMPONENT 110, SPINDLE POLE BODY COMPONENT SPC97, SPINDLE POLE BODY COMPONENT SPC98, ... | | Authors: | Greenberg, C.H, Kollman, J, Zelter, A, Johnson, R, MacCoss, M.J, Davis, T.N, Agard, D.A, Sali, A. | | Deposit date: | 2015-10-29 | | Release date: | 2016-01-13 | | Last modified: | 2024-05-08 | | Method: | ELECTRON MICROSCOPY (6.9 Å) | | Cite: | Structure of Gamma-Tubulin Small Complex Based on a Cryo-Em Map, Chemical Cross-Links, and a Remotely Related Structure.
J.Struct.Biol., 194, 2016
|
|
5FM1
 | | Structure of gamma-tubulin small complex based on a cryo-EM map, chemical cross-links, and a remotely related structure | | Descriptor: | SPINDLE POLE BODY COMPONENT 110, SPINDLE POLE BODY COMPONENT SPC97, SPINDLE POLE BODY COMPONENT SPC98, ... | | Authors: | Greenberg, C.H, Kollman, J, Zelter, A, Johnson, R, MacCoss, M.J, Davis, T.N, Agard, D.A, Sali, A. | | Deposit date: | 2015-10-30 | | Release date: | 2016-02-03 | | Last modified: | 2024-05-08 | | Method: | ELECTRON MICROSCOPY (8 Å) | | Cite: | Structure of Gamma-Tubulin Small Complex Based on a Cryo-Em Map, Chemical Cross-Links, and a Remotely Related Structure.
J.Struct.Biol., 194, 2016
|
|
6L3H
 | | Cryo-EM structure of dimeric quinol dependent Nitric Oxide Reductase (qNOR) from the pathogen Neisseria meninigitidis | | Descriptor: | CALCIUM ION, FE (III) ION, Nitric-oxide reductase, ... | | Authors: | Jamali, M.M.A, Gopalasingam, C.C, Johnson, R.M, Tosha, T, Muench, S.P, Muramoto, K, Antonyuk, S.V, Shiro, Y, Hasnain, S.S. | | Deposit date: | 2019-10-11 | | Release date: | 2020-04-01 | | Last modified: | 2024-03-27 | | Method: | ELECTRON MICROSCOPY (3.06 Å) | | Cite: | The active form of quinol-dependent nitric oxide reductase fromNeisseria meningitidisis a dimer.
Iucrj, 7, 2020
|
|
6QQ5
 | | Cryo-EM structure of dimeric quinol dependent nitric oxide reductase (qNOR) from Alcaligenes xylosoxidans | | Descriptor: | CALCIUM ION, FE (III) ION, Nitric oxide reductase subunit B, ... | | Authors: | Gopalasingam, C.C, Johnson, R.M, Chiduza, G.N, Tosha, T, Yamamoto, M, Shiro, Y, Antonyuk, S.V, Muench, S.P, Hasnain, S.S. | | Deposit date: | 2019-02-17 | | Release date: | 2019-09-11 | | Last modified: | 2024-05-15 | | Method: | ELECTRON MICROSCOPY (3.9 Å) | | Cite: | Dimeric structures of quinol-dependent nitric oxide reductases (qNORs) revealed by cryo-electron microscopy.
Sci Adv, 5, 2019
|
|
6T6V
 | | Glu-494-Ala inactive monomer of a quinol dependent Nitric Oxide Reductase (qNOR) from Alcaligenes xylosoxidans | | Descriptor: | CALCIUM ION, Nitric oxide reductase subunit B, PROTOPORPHYRIN IX CONTAINING FE | | Authors: | Gopalasingam, C.C, Johnson, R.M, Antonyuk, S.V, Muench, S.P, Hasnain, S.S. | | Deposit date: | 2019-10-19 | | Release date: | 2020-04-01 | | Last modified: | 2024-05-22 | | Method: | ELECTRON MICROSCOPY (4.5 Å) | | Cite: | The active form of quinol-dependent nitric oxide reductase fromNeisseria meningitidisis a dimer.
Iucrj, 7, 2020
|
|
3ITE
 | | The third adenylation domain of the fungal SidN non-ribosomal peptide synthetase | | Descriptor: | CHLORIDE ION, SULFATE ION, SidN siderophore synthetase | | Authors: | Lee, T.V, Lott, J.S, Johnson, R.D, Johnson, L.J, Arcus, V.L. | | Deposit date: | 2009-08-28 | | Release date: | 2009-11-17 | | Last modified: | 2014-02-05 | | Method: | X-RAY DIFFRACTION (2 Å) | | Cite: | Structure of a eukaryotic nonribosomal peptide synthetase adenylation domain that activates a large hydroxamate amino acid in siderophore biosynthesis
J.Biol.Chem., 285, 2010
|
|
6DGB
 | | Crystal structure of the C-terminal catalytic domain of IS1535 TnpA, an IS607-like serine recombinase | | Descriptor: | IS607 family transposase IS1535 | | Authors: | Chen, W.Y, Hancock, S.P, Cascio, D, Johnson, R.C. | | Deposit date: | 2018-05-17 | | Release date: | 2018-07-18 | | Last modified: | 2024-03-13 | | Method: | X-RAY DIFFRACTION (2.52 Å) | | Cite: | Multiple serine transposase dimers assemble the transposon-end synaptic complex during IS607-family transposition.
Elife, 7, 2018
|
|
6DGC
 | | Crystal structure of the C-terminal catalytic domain of ISC1926 TnpA, an IS607-like serine recombinase | | Descriptor: | ISC1926 TnpA C-terminal catalytic domain | | Authors: | Hancock, S.P, Kumar, P, Cascio, D, Johnson, R.C. | | Deposit date: | 2018-05-17 | | Release date: | 2018-07-18 | | Last modified: | 2023-10-11 | | Method: | X-RAY DIFFRACTION (2.92 Å) | | Cite: | Multiple serine transposase dimers assemble the transposon-end synaptic complex during IS607-family transposition.
Elife, 7, 2018
|
|
1IJW
 | | Testing the Water-Mediated Hin Recombinase DNA Recognition by Systematic Mutations. | | Descriptor: | 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, 5'-D(*AP*TP*(CBR)P*TP*TP*AP*TP*CP*AP*AP*AP*AP*AP*C)-3', 5'-D(*TP*GP*TP*TP*TP*TP*TP*GP*AP*TP*AP*AP*GP*A)-3', ... | | Authors: | Chiu, T.K, Sohn, C, Johnson, R.C, Dickerson, R.E. | | Deposit date: | 2001-04-30 | | Release date: | 2002-02-22 | | Last modified: | 2024-04-03 | | Method: | X-RAY DIFFRACTION (2.4 Å) | | Cite: | Testing water-mediated DNA recognition by the Hin recombinase.
EMBO J., 21, 2002
|
|
1JKO
 | | Testing the Water-Mediated HIN Recombinase DNA Recognition by Systematic Mutations | | Descriptor: | 2-AMINO-2-HYDROXYMETHYL-PROPANE-1,3-DIOL, 5'-D(*AP*TP*CP*TP*TP*AP*CP*CP*AP*AP*AP*AP*AP*C)-3', 5'-D(*TP*GP*TP*TP*TP*TP*TP*GP*GP*TP*AP*AP*GP*A)-3', ... | | Authors: | Chiu, T.K, Sohn, C, Johnson, R.C, Dickerson, R.E. | | Deposit date: | 2001-07-12 | | Release date: | 2002-02-22 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (2.24 Å) | | Cite: | Testing water-mediated DNA recognition by the Hin recombinase.
EMBO J., 21, 2002
|
|
