4IHV
Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)
Summary for 4IHV
| Entry DOI | 10.2210/pdb4ihv/pdb |
| Related | 4IHW 4IHX 4IHY |
| Descriptor | DNA-binding protein fis, 27-bp DNA Strand A, 27-bp DNA Strand B, ... (4 entities in total) |
| Functional Keywords | protein-dna complex, hth domain, minor groove compression, dna bending, indirect recognition, transcription-dna complex, transcription/dna |
| Biological source | Escherichia coli |
| Total number of polymer chains | 4 |
| Total formula weight | 39093.61 |
| Authors | Hancock, S.P.,Cascio, D.,Johnson, R.C. (deposition date: 2012-12-19, release date: 2013-05-01, Last modification date: 2023-09-20) |
| Primary citation | Hancock, S.P.,Ghane, T.,Cascio, D.,Rohs, R.,Di Felice, R.,Johnson, R.C. Control of DNA minor groove width and Fis protein binding by the purine 2-amino group. Nucleic Acids Res., 41:6750-6760, 2013 Cited by PubMed Abstract: The width of the DNA minor groove varies with sequence and can be a major determinant of DNA shape recognition by proteins. For example, the minor groove within the center of the Fis-DNA complex narrows to about half the mean minor groove width of canonical B-form DNA to fit onto the protein surface. G/C base pairs within this segment, which is not contacted by the Fis protein, reduce binding affinities up to 2000-fold over A/T-rich sequences. We show here through multiple X-ray structures and binding properties of Fis-DNA complexes containing base analogs that the 2-amino group on guanine is the primary molecular determinant controlling minor groove widths. Molecular dynamics simulations of free-DNA targets with canonical and modified bases further demonstrate that sequence-dependent narrowing of minor groove widths is modulated almost entirely by the presence of purine 2-amino groups. We also provide evidence that protein-mediated phosphate neutralization facilitates minor groove compression and is particularly important for binding to non-optimally shaped DNA duplexes. PubMed: 23661683DOI: 10.1093/nar/gkt357 PDB entries with the same primary citation |
| Experimental method | X-RAY DIFFRACTION (2.716 Å) |
Structure validation
Download full validation report






