4IHV
Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)
Entity
| Entity ID | Chain ID | Description | Type | Chain length | Formula weight | Number of molecules | DB Name (Accession) | Biological source | Descriptive keywords |
| 1 | A, B | DNA-binding protein fis | polymer | 98 | 11252.9 | 2 | UniProt (C9QXL3) In PDB | Escherichia coli | Factor for Inversion Stimulation |
| 2 | C | 27-bp DNA Strand A | polymer | 27 | 8360.4 | 1 | |||
| 3 | D | 27-bp DNA Strand B | polymer | 27 | 8227.4 | 1 | |||
| 4 | water | water | 18.0 | 5 | Chemie (HOH) |
Sequence viewer
Contents of the asymmetric unit
| Polymers | Number of chains | 4 |
| Total formula weight | 39093.6 | |
| All* | Total formula weight | 39093.6 |
