4IHV
Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)
Functional Information from GO Data
| Chain | GOid | namespace | contents |
| A | 0003677 | molecular_function | DNA binding |
| A | 0006355 | biological_process | regulation of DNA-templated transcription |
| A | 0043565 | molecular_function | sequence-specific DNA binding |
| B | 0003677 | molecular_function | DNA binding |
| B | 0006355 | biological_process | regulation of DNA-templated transcription |
| B | 0043565 | molecular_function | sequence-specific DNA binding |






