7AJU
 
 | | Cryo-EM structure of the 90S-exosome super-complex (state Post-A1-exosome) | | Descriptor: | 13 kDa ribonucleoprotein-associated protein, 18S rRNA, 40S ribosomal protein S1-A, ... | | Authors: | Cheng, J, Lau, B, Flemming, D, Venuta, G.L, Berninghausen, O, Beckmann, R, Hurt, E. | | Deposit date: | 2020-09-29 | | Release date: | 2020-12-30 | | Last modified: | 2024-05-01 | | Method: | ELECTRON MICROSCOPY (3.8 Å) | | Cite: | Structure of the Maturing 90S Pre-ribosome in Association with the RNA Exosome.
Mol.Cell, 81, 2021
|
|
3SJE
 | | X-ray structure of human glutamate carboxypeptidase II (the E424A inactive mutant) in complex with N-acetyl-aspartyl-aminononanoic acid | | Descriptor: | (2S)-2-[(N-acetyl-L-alpha-aspartyl)amino]nonanoic acid, 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, ... | | Authors: | Plechanovova, A, Byun, Y, Alquicer, G, Skultetyova, L, Mlcochova, P, Nemcova, A, Kim, H, Navratil, M, Mease, R, Lubkowski, J, Pomper, M, Konvalinka, J, Rulisek, L, Barinka, C. | | Deposit date: | 2011-06-21 | | Release date: | 2011-10-05 | | Last modified: | 2020-07-29 | | Method: | X-RAY DIFFRACTION (1.7 Å) | | Cite: | Novel Substrate-Based Inhibitors of Human Glutamate Carboxypeptidase II with Enhanced Lipophilicity.
J.Med.Chem., 54, 2011
|
|
7B08
 | | TgoT apo | | Descriptor: | DNA polymerase, THYMIDINE-5'-TRIPHOSPHATE, TRIETHYLENE GLYCOL | | Authors: | Samson, C, Legrand, P, Tekpinar, M, Rozenski, J, Abramov, M, Holliger, P, Pinheiro, V, Herdewijn, P, Delarue, M. | | Deposit date: | 2020-11-18 | | Release date: | 2020-12-30 | | Last modified: | 2024-01-31 | | Method: | X-RAY DIFFRACTION (2.394 Å) | | Cite: | Structural Studies of HNA Substrate Specificity in Mutants of an Archaeal DNA Polymerase Obtained by Directed Evolution.
Biomolecules, 10, 2020
|
|
7DR8
 | | Crystal structure of MERS-CoV 3CL protease in spacegroup P212121 | | Descriptor: | 3C-like proteinase | | Authors: | Zhang, Y.T, Gao, H.X, Zhou, H, Zhong, F.L, Hu, X.H, Zhou, X.L, Lin, C, Wang, Q.S, Li, J, Zhang, J. | | Deposit date: | 2020-12-26 | | Release date: | 2021-12-29 | | Last modified: | 2023-11-29 | | Method: | X-RAY DIFFRACTION (2.338149 Å) | | Cite: | Crystal structure of MERS-CoV 3CL protease in spacegroup P212121
To Be Published
|
|
7DR9
 | |
6UN9
 | | Crystal Structure of the Q7VLF5_HAEDU protein from Haemophilus ducreyi. Northeast Structural Genomics Consortium Target Hdr25 | | Descriptor: | Uncharacterized protein | | Authors: | Vorobiev, S.M, Seetharaman, J, Kolev, M, Xiao, R, Everett, J.K, Acton, T.B, Montelione, G.T, Tong, L, Hunt, J.F, Northeast Structural Genomics Consortium (NESG) | | Deposit date: | 2019-10-11 | | Release date: | 2020-12-09 | | Method: | X-RAY DIFFRACTION (2.8 Å) | | Cite: | Crystal Structure of the Q7VLF5_HAEDU protein from Haemophilus ducreyi. Northeast Structural Genomics Consortium Target Hdr25
To Be Published
|
|
3SMT
 | | Crystal structure of human SET domain-containing protein3 | | Descriptor: | ACETATE ION, ARSENIC, Histone-lysine N-methyltransferase setd3, ... | | Authors: | Dong, A, Zeng, H, Walker, J.R, Loppnau, P, Bountra, C, Weigelt, J, Arrowsmith, C.H, Edwards, A.M, Min, J, Wu, H, Structural Genomics Consortium (SGC) | | Deposit date: | 2011-06-28 | | Release date: | 2011-07-20 | | Last modified: | 2017-11-08 | | Method: | X-RAY DIFFRACTION (2.04 Å) | | Cite: | Crystal structure of human SET domain-containing protein3
To be Published
|
|
7DRA
 | |
7AJN
 | | Crystal Structure of the first bromodomain of BRD4 in complex with a BzD ligand | | Descriptor: | 1,2-ETHANEDIOL, Bromodomain-containing protein 4, ~{N}-(1-adamantylmethyl)-2-[(7~{R},9~{S})-7-(4-chlorophenyl)-4,5,13-trimethyl-3-thia-1,8,11,12-tetrazatricyclo[8.3.0.0^{2,6}]trideca-2(6),4,10,12-tetraen-9-yl]ethanamide | | Authors: | Picaud, S, Hassel-Hart, S, Tobias, K, Spencer, J, von Delft, F, Arrowsmith, C.H, Edwards, A.M, Bountra, C, Filippakopoulos, P. | | Deposit date: | 2020-09-29 | | Release date: | 2020-12-02 | | Last modified: | 2024-01-31 | | Method: | X-RAY DIFFRACTION (1.48 Å) | | Cite: | Crystal Structure of the first bromodomain of BRD4 in complex with a BzD ligand
To Be Published
|
|
7B0G
 | | TgoT_6G12 binary with 2 hCTPs | | Descriptor: | CYTIDINE-5'-TRIPHOSPHATE, DNA (5'-D(P*AP*TP*TP*GP*GP*CP*TP*GP*CP*CP*CP*TP*CP*C)-3'), DNA (5'-D(P*GP*GP*AP*GP*GP*GP*CP*AP*GP*()P*())-3'), ... | | Authors: | Samson, C, Legrand, P, Tekpinar, M, Rozenski, J, Abramov, M, Holliger, P, Pinheiro, V, Herdewijn, P, Delarue, M. | | Deposit date: | 2020-11-19 | | Release date: | 2020-12-30 | | Last modified: | 2024-01-31 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | Structural Studies of HNA Substrate Specificity in Mutants of an Archaeal DNA Polymerase Obtained by Directed Evolution.
Biomolecules, 10, 2020
|
|
7RWR
 | | An RNA aptamer that decreases flavin redox potential | | Descriptor: | FLAVIN MONONUCLEOTIDE, RNA (38-MER) | | Authors: | Gremminger, T, Li, J, Chen, S, Heng, X. | | Deposit date: | 2021-08-20 | | Release date: | 2022-07-20 | | Last modified: | 2024-05-15 | | Method: | SOLUTION NMR | | Cite: | An RNA aptamer that shifts the reduction potential of metabolic cofactors.
Nat.Chem.Biol., 18, 2022
|
|
7AME
 | | TYPE III ANTIFREEZE PROTEIN ISOFORM HPLC 12 T15A | | Descriptor: | PROTEIN (ANTIFREEZE PROTEIN TYPE III) | | Authors: | Graether, S.P, Deluca, C.I, Baardsnes, J, Hill, G.A, Davies, P.L, Jia, Z. | | Deposit date: | 1999-01-24 | | Release date: | 1999-04-29 | | Last modified: | 2023-09-20 | | Method: | X-RAY DIFFRACTION (1.7 Å) | | Cite: | Quantitative and qualitative analysis of type III antifreeze protein structure and function.
J.Biol.Chem., 274, 1999
|
|
8PK3
 | | CryoEM reconstruction of hemagglutinin HK68 of Influenza A virus bound to an Affimer reagent | | Descriptor: | 2-acetamido-2-deoxy-beta-D-glucopyranose, 2-acetamido-2-deoxy-beta-D-glucopyranose-(1-4)-2-acetamido-2-deoxy-beta-D-glucopyranose, Affimer molecule (A31), ... | | Authors: | Debski-Antoniak, O, Flynn, A, Klebl, D.P, Tiede, C, Muench, S, Tomlinson, D, Fontana, J. | | Deposit date: | 2023-06-24 | | Release date: | 2024-01-03 | | Last modified: | 2024-05-29 | | Method: | ELECTRON MICROSCOPY (3.4 Å) | | Cite: | Exploiting the Affimer platform against influenza A virus
To Be Published
|
|
3NXB
 | | Crystal Structure of the Bromodomain of human CECR2 | | Descriptor: | 1,2-ETHANEDIOL, Cat eye syndrome critical region protein 2 | | Authors: | Filippakopoulos, P, Picaud, S, Keates, T, Muniz, J, von Delft, F, Arrowsmith, C.H, Edwards, A, Weigelt, J, Bountra, C, Knapp, S, Structural Genomics Consortium (SGC) | | Deposit date: | 2010-07-13 | | Release date: | 2010-08-18 | | Last modified: | 2023-09-06 | | Method: | X-RAY DIFFRACTION (1.83 Å) | | Cite: | Histone recognition and large-scale structural analysis of the human bromodomain family.
Cell(Cambridge,Mass.), 149, 2012
|
|
2IL6
 | | HUMAN INTERLEUKIN-6, NMR, 32 STRUCTURES | | Descriptor: | INTERLEUKIN-6 | | Authors: | Xu, G.Y, Yu, H.A, Hong, J, Stahl, M, Mcdonagh, T, Kay, L.E, Cumming, D.A. | | Deposit date: | 1997-01-31 | | Release date: | 1998-02-04 | | Last modified: | 2022-03-09 | | Method: | SOLUTION NMR | | Cite: | Solution structure of recombinant human interleukin-6.
J.Mol.Biol., 268, 1997
|
|
7B3C
 | | Structure of elongating SARS-CoV-2 RNA-dependent RNA polymerase with Remdesivir at position -4 (structure 2) | | Descriptor: | DNA/RNA (5'-R(P*CP*UP*AP*CP*GP*CP*A)-D(P*(RMP))-R(P*GP*UP*G)-3'), Non-structural protein 7, Non-structural protein 8, ... | | Authors: | Kokic, G, Hillen, H.S, Tegunov, D, Dienemann, C, Seitz, F, Schmitzova, J, Farnung, L, Siewert, A, Hoebartner, C, Cramer, P. | | Deposit date: | 2020-11-30 | | Release date: | 2020-12-23 | | Last modified: | 2024-07-10 | | Method: | ELECTRON MICROSCOPY (3.4 Å) | | Cite: | Mechanism of SARS-CoV-2 polymerase stalling by remdesivir.
Nat Commun, 12, 2021
|
|
6TVJ
 | |
7SQ2
 | | Reprocessed and refined structure of Phospholipase C-beta and Gq signaling complex | | Descriptor: | 1-phosphatidylinositol 4,5-bisphosphate phosphodiesterase beta-3, ACETATE ION, CALCIUM ION, ... | | Authors: | Endo-Streeter, S.T, Sondek, J, Harden, T.K. | | Deposit date: | 2021-11-04 | | Release date: | 2021-11-17 | | Last modified: | 2023-10-18 | | Method: | X-RAY DIFFRACTION (2.6 Å) | | Cite: | Kinetic Scaffolding Mediated by a Phospholipase C-{beta} and Gq Signaling Complex
Science, 330, 2010
|
|
8PQN
 | | NQO1 bound to RBS-10 | | Descriptor: | FLAVIN-ADENINE DINUCLEOTIDE, NAD(P)H dehydrogenase [quinone] 1, ~{N}-[4-[(3-methylphenyl)carbonylamino]phenyl]-5-nitro-furan-2-carboxamide | | Authors: | Pous, J, Jose-Duran, F, Mayor-Ruiz, C, Riera, A. | | Deposit date: | 2023-07-11 | | Release date: | 2024-01-10 | | Last modified: | 2024-03-20 | | Method: | X-RAY DIFFRACTION (3.8 Å) | | Cite: | Discovery and Mechanistic Elucidation of NQO1-Bioactivatable Small Molecules That Overcome Resistance to Degraders.
Angew.Chem.Int.Ed.Engl., 63, 2024
|
|
1FG0
 | | LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND | | Descriptor: | 23S RIBOSOMAL RNA, 5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' | | Authors: | Nissen, P, Hansen, J, Ban, N, Moore, P.B, Steitz, T.A. | | Deposit date: | 2000-07-26 | | Release date: | 2000-08-28 | | Last modified: | 2024-02-07 | | Method: | X-RAY DIFFRACTION (3 Å) | | Cite: | The structural basis of ribosome activity in peptide bond synthesis.
Science, 289, 2000
|
|
2J0I
 | | CRYSTAL STRUCTURE OF THE HUMAN P21-ACTIVATED KINASE 4 | | Descriptor: | 1,2-ETHANEDIOL, SERINE/THREONINE-PROTEIN KINASE PAK 4 | | Authors: | Debreczeni, J.E, Eswaran, J, Ugochukwu, E, Papagrigoriou, E, Turnbull, A, von Delft, F, Arrowsmith, C, Weigelt, J, Edwards, A, Sundstrom, M, Knapp, S. | | Deposit date: | 2006-08-03 | | Release date: | 2006-08-17 | | Last modified: | 2023-12-13 | | Method: | X-RAY DIFFRACTION (1.6 Å) | | Cite: | Crystal Structure of the Human P21-Activated Kinase 4
To be Published
|
|
8PNT
 | | Structure of the human nuclear cap-binding complex bound to PHAX and m7G-capped RNA | | Descriptor: | 7N-METHYL-8-HYDROGUANOSINE-5'-TRIPHOSPHATE, Nuclear cap-binding protein subunit 1, Nuclear cap-binding protein subunit 2, ... | | Authors: | Dubiez, E, Pellegrini, E, Foucher, A.E, Cusack, S, Kadlec, J. | | Deposit date: | 2023-07-01 | | Release date: | 2024-01-17 | | Method: | ELECTRON MICROSCOPY (3.46 Å) | | Cite: | Structural basis for competitive binding of productive and degradative co-transcriptional effectors to the nuclear cap-binding complex.
Cell Rep, 43, 2024
|
|
7ANW
 | | hSARM1 NAD+ complex | | Descriptor: | NAD(+) hydrolase SARM1, NICOTINAMIDE-ADENINE-DINUCLEOTIDE | | Authors: | Sporny, M, Guez-Haddad, J, Khazma, T, Yaron, A, Mim, C, Isupov, M.N, Zalk, R, Dessau, M, Hons, M, Opatowsky, Y. | | Deposit date: | 2020-10-13 | | Release date: | 2020-11-11 | | Last modified: | 2024-05-01 | | Method: | ELECTRON MICROSCOPY (2.68 Å) | | Cite: | Structural basis for SARM1 inhibition and activation under energetic stress.
Elife, 9, 2020
|
|
8PV8
 | | Chaetomium thermophilum pre-60S State 4 - post-5S rotation with Rix1 complex without Foot - composite structure | | Descriptor: | 26S rRNA, 5.8S rRNA, 5S rRNA, ... | | Authors: | Thoms, M, Cheng, J, Denk, T, Berninghausen, O, Beckmann, R. | | Deposit date: | 2023-07-17 | | Release date: | 2024-01-10 | | Last modified: | 2024-01-17 | | Method: | ELECTRON MICROSCOPY (2.91 Å) | | Cite: | Structural insights into coordinating 5S RNP rotation with ITS2 pre-RNA processing during ribosome formation.
Embo Rep., 24, 2023
|
|
1NH0
 | | 1.03 A structure of HIV-1 protease: inhibitor binding inside and outside the active site | | Descriptor: | BETA-MERCAPTOETHANOL, PROTEASE RETROPEPSIN, SULFATE ION, ... | | Authors: | Brynda, J, Rezacova, P, Fabry, M, Horejsi, M, Hradilek, M, Soucek, M, Konvalinka, J, Sedlacek, J. | | Deposit date: | 2002-12-18 | | Release date: | 2004-04-13 | | Last modified: | 2023-08-16 | | Method: | X-RAY DIFFRACTION (1.03 Å) | | Cite: | A Phenylnorstatine Inhibitor Binding to HIV-1 Protease: Geometry,
Protonation, and Subsite-Pocket Interactions Analyzed at Atomic Resolution
J.Med.Chem., 47, 2004
|
|
